* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download Understanding DNA
Human genome wikipedia , lookup
Comparative genomic hybridization wikipedia , lookup
Mitochondrial DNA wikipedia , lookup
DNA profiling wikipedia , lookup
Genetic engineering wikipedia , lookup
Nutriepigenomics wikipedia , lookup
Site-specific recombinase technology wikipedia , lookup
Genomic library wikipedia , lookup
SNP genotyping wikipedia , lookup
Designer baby wikipedia , lookup
No-SCAR (Scarless Cas9 Assisted Recombineering) Genome Editing wikipedia , lookup
DNA polymerase wikipedia , lookup
Cancer epigenetics wikipedia , lookup
Bisulfite sequencing wikipedia , lookup
Genealogical DNA test wikipedia , lookup
Primary transcript wikipedia , lookup
Gel electrophoresis of nucleic acids wikipedia , lookup
United Kingdom National DNA Database wikipedia , lookup
DNA damage theory of aging wikipedia , lookup
Genetic code wikipedia , lookup
Epigenomics wikipedia , lookup
Molecular cloning wikipedia , lookup
DNA vaccination wikipedia , lookup
Cell-free fetal DNA wikipedia , lookup
Microevolution wikipedia , lookup
Non-coding DNA wikipedia , lookup
Point mutation wikipedia , lookup
DNA supercoil wikipedia , lookup
Therapeutic gene modulation wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
Nucleic acid double helix wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
Helitron (biology) wikipedia , lookup
Extrachromosomal DNA wikipedia , lookup
History of genetic engineering wikipedia , lookup
Nucleic acid analogue wikipedia , lookup
http://videos.howstuffworks.com/hsw/24990-geneticsunderstanding-dna-video.htm Understanding DNA: How Stuff Works DNA BASE PAIRS Genetic Variation: A Key to Survival GENETIC VARIATION leads to Adaptation How do malaria parasites survive anti-malaria medications? RESISTANT STRAIN How Do Cells Reproduce? http://luigigalvani5.blogspot.com/2008/...ary.html Identical copy http://waynesword.palomar.edu/lmexer2a.htm Different copy Mixing of Genes CROSSING OVER MINI-LAB: Observing cell reproduction 1. Mount a prepared slide of a cell undergoing cell division. 2. Draw the cell and label the ff structures: a. cell membrane Note: Follow guidelines on b. chromosomes Making Diagrams 3. Describe what you see. 1. Accurate representation 2. 2-D diagram 3. Proper labels 4. Neatly presented Crossing over: Why we are different from our parents VC; Where do genes come from From Gene to Protein: An exercise in breaking the code 1. DNA COPIES ITSELF: Base pairings: A- T DNA molecule unzips breaking the base pairs forming 2 sides VC: DNA Replication C–G Given the code of a DNA molecule, what would be the code of the new DNA strand? A: TACCGGATGCCAGATCAAATC What is the other side? __________________________ B: TACGGGGGCGTAACCACAACT What is the other side? __________________________ VC: How DNA copies itself From DNA to protein 2. CODE IS READ. The code of the new strand (DNA copy) is READ with the T replaced with a new base Uracil or U. A: ____________________________________ B: ____________________________________ 3. CODE IS TRANSLATED. The code is read in groups of 3 called codons). A: ____________________________________ B: ____________________________________ Find the Amino Acid sequence that is coded: Use the following guide. A: ____________________________________ B: ____________________________________ Genes( DNA) New copy (RNA) is read and translated Make copies of itself Crossover (mixing of code) www.squidoo.com/geneticsresearch A trait is expressed VC: What is phenotype Amino acids (protein) are formed DNA Cracking the Code VC: Cracking the code copied and read RNA translated http://entomology.wisc.edu/~goodman/wgr...rch.html PROTEIN While the copying of DNA is a very accurate process, what happens when a letter is altered? VC: DNA Mutation Given the code of a DNA molecule, what would be the code of the new DNA strand? A: TACCGGATGCCAGATCAAATC What is the other side? AT_GCCTACGGTCTAGTTTAG B: TACGGGGGCGTAACCACAACT What is the other side? ATGCGCCCGCATTGGTGTTGA