* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download Transcription & Translation PowerPoint
Cre-Lox recombination wikipedia , lookup
Peptide synthesis wikipedia , lookup
Non-coding DNA wikipedia , lookup
RNA polymerase II holoenzyme wikipedia , lookup
Promoter (genetics) wikipedia , lookup
Eukaryotic transcription wikipedia , lookup
RNA interference wikipedia , lookup
Community fingerprinting wikipedia , lookup
Cell-penetrating peptide wikipedia , lookup
RNA silencing wikipedia , lookup
Molecular evolution wikipedia , lookup
Transcriptional regulation wikipedia , lookup
Bottromycin wikipedia , lookup
Silencer (genetics) wikipedia , lookup
List of types of proteins wikipedia , lookup
Deoxyribozyme wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
Polyadenylation wikipedia , lookup
Point mutation wikipedia , lookup
Non-coding RNA wikipedia , lookup
Amino acid synthesis wikipedia , lookup
Gene expression wikipedia , lookup
Nucleic acid analogue wikipedia , lookup
Expanded genetic code wikipedia , lookup
Biochemistry wikipedia , lookup
Genetic code wikipedia , lookup
Which of the following reactions occurs when a dipeptide is formed from amino acids? A. Hydrolysis B. Denaturation C. Condensation D. Oxidation What is removed to form mature eukaryotic mRNA? A. RNA primers B. Exons C. RNA polymerases D. Introns A certain gene codes for a polypeptide that is 120 amino acids long. Approximately how many nucleotides long is the mRNA that codes for this polypeptide likely to be? A. 30 B. 40 C. 360 D. 480 Imagine that an mRNA leaves the nucleus of a eukaryotic cell with the following base sequence: AUGCCCCGCACGUUUCCAAGCCCCGGG 1. Determine the amino acids in sequence that are coded for by the above mRNA molecule. 2. Determine the DNA code sequence which gave rise to the above mRNA codons. 3. What would the amino acid sequence be if the first cytosine of the mRNA molecule was replaced with a uracil? (This would be due to a substitution mutation occurring to the DNA molecule which transcribed this mRNA.)