* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Download Regents Biology How does mRNA code for
Designer baby wikipedia , lookup
United Kingdom National DNA Database wikipedia , lookup
Bisulfite sequencing wikipedia , lookup
Epigenetics of neurodegenerative diseases wikipedia , lookup
Gel electrophoresis of nucleic acids wikipedia , lookup
Biology and consumer behaviour wikipedia , lookup
RNA interference wikipedia , lookup
DNA polymerase wikipedia , lookup
DNA vaccination wikipedia , lookup
Molecular cloning wikipedia , lookup
RNA silencing wikipedia , lookup
Microevolution wikipedia , lookup
Epigenomics wikipedia , lookup
Frameshift mutation wikipedia , lookup
Nucleic acid double helix wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
DNA supercoil wikipedia , lookup
History of genetic engineering wikipedia , lookup
Extrachromosomal DNA wikipedia , lookup
Non-coding DNA wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
Cell-free fetal DNA wikipedia , lookup
Nucleic acid tertiary structure wikipedia , lookup
Point mutation wikipedia , lookup
Synthetic biology wikipedia , lookup
Helitron (biology) wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
Polyadenylation wikipedia , lookup
Therapeutic gene modulation wikipedia , lookup
History of RNA biology wikipedia , lookup
Deoxyribozyme wikipedia , lookup
Nucleic acid analogue wikipedia , lookup
Expanded genetic code wikipedia , lookup
Non-coding RNA wikipedia , lookup
Genetic code wikipedia , lookup
Transfer RNA wikipedia , lookup
Messenger RNA wikipedia , lookup
From gene to protein: protein transcription Regents Biology translation Transcription Making mRNA from DNA DNA strand is the template (pattern) match bases U:A G:C Enzyme RNA polymerase Regents Biology Transcription Occurs in the nucleus 3 stages Initiation Elongation termination Regents Biology Transcription Initiation DNA is unwound and unzipped in the area of the gene to be transcribed by RNA polymerase which binds to the promoter region “upstream” of gene (promoter region signals which DNA strand is to be copied) Region has a high concentration of A’s & T’s (called the TATA box) Regents Biology Matching bases of DNA & RNA Double stranded DNA unzips T G G T A C A G C T A G T C A T CG T A C CG T Regents Biology Matching bases of DNA & RNA Double stranded DNA unzips T G G T A C A G C T A G T C A T CG T A C CG T Regents Biology Transcription Elongation With 1 DNA strand serving as the “template strand” RNA polymerase attaches ribonucleotides in 5’ to 3’ direction By complementary base pairing Regents Biology Matching bases of DNA & RNA Match RNA bases to DNA C G one of the bases on DNA strands U A G G U U C A AG A C G A U A C A C C RNA polymerase A U G T G G T A C A G C T A G T C A T CG T A C CG T Regents Biology U C Regents Biology Matching bases of DNA & RNA U instead of T is matched to A aa aa aa DNA mRNA TACGCACATTTACGTACG aa aa aa AUGCGUGUAAAUGCAUGC aa aa aa aa ribosome A C C A U G U C G A U C A G U A G C A U G G C A Regents Biology Transcription Termination RNA polymerase transcribes the DNA sequence up to the end of the gene where a “terminator sequence” is encountered mRNA transcript is released from DNA Strand Prokaryotes & eukaryotes have different terminator sequences Regents Biology mRNA modification In eukaryotes, mRNA is modified prior to leaving the nucleus (ensuring it remains intact) 1. Capping A 5’ cap is added to the start of the primary transcript (protects mRNA from digestion as it exits the nucleus and enters the cytoplasm) Regents Biology mRNA modification In eukaryotes, mRNA is modified prior to leaving the nucleus (ensuring it remains intact) 1. 2. Capping Tailing Approximately 200 adenine ribonucleotides are added to the 3’ end Called a poly A tail 3. Introns Regents Biology mRNA modification In eukaryotes, mRNA is modified prior to leaving the nucleus (ensuring it remains intact) 1. 2. 3. Capping Tailing Introns Non coding regions Removed before translation by spliceosomes so that only exons (coding regions) remain Regents Biology mRNA modification The modified mRNA strand now = mRNA transcript Post transcriptional Editing Video Regents Biology cytoplasm aa aa aa aa aa aa proteinaa aa aa aa nucleus ribosome A C C A U G U C G A U C A G U A G C A U G G C A Regents Biology trait How does mRNA code for proteins mRNA leaves nucleus mRNA goes to ribosomes in cytoplasm Proteins built from instructions on mRNA How? mRNA A C C A U G U C G A U C A GU A GC A U G GC A aa Regents Biology aa aa aa aa aa aa aa Translation Occurs in the cytoplasm 3 stages 1. 2. 3. Initiation Elongation Termination Regents Biology Translation 1. Initiation An initiation complex is formed when the first tRNA is positioned on the ribosomal surface Must be accurate or the reading frame will be inaccurate This complex then binds to mRNA at the beginning of the gene 2 ribosomal subunits recognize the 5’ cap 2. 3. Elongation Termination Regents Biology Translation tRNA A single stranded, Clover leaf shaped, Nucleic acid Contains the anticodon (sequence of 3 bases) that recognizes the codon of mRNA Each kind of tRNA carries a corresponding amino acid at its 3’ end Regents Biology Translation 1. 2. Initiation Elongation Code on mRNA is read in triplets (codons) AUG (methionine) is the start codon in eukaryotes (fMET in prokaryotes) Ribosomes have 2 sites for tRNA attachment A (acceptor) site and P (peptide) site AUG enters the P site and is paired with the correct tRNA anticodon 3. Termination Regents Biology Translation 1. 2. Initiation Elongation Then the A site is filled with 2nd codon and its complimentary tRNA anticodon When their, aa are bonded, the ribosome moves along the mRNA strand in the 5’ to 3’ direction The 2nd codon and its tRNA moves to the P site and the 3rd codon moves into the A site and is paired with its complementary tRNA, and so on AUG is the only codon that begins in the P site Released tRNA reunite with fresh aa from the cytoplasm Regents Biology 3. Termination Translation 1. 2. 3. Initiation Elongation Termination 3 stop codons UGA, UAG, UAA have no complementary tRNA Release factor (a protein) releases the polypeptide chain from the ribosome Ribosomal subunits separate Translation ends Protein is folded and modified as necessary Video (20 seconds) Regents Biology How does mRNA code for proteins? TACGCACATTTACGTACGCGG DNA ribosome AUGCGUGUAAAUGCAUGCGCC mRNA ? Met Arg Val Asn Ala Cys Ala protein aa Regents Biology aa aa aa aa aa aa How can you code for 20 amino acids with only 4 DNA bases (A,U,G,C)? aa Codon Sequence of 3 adjacent nucleotides that code for 1 amino acid Basic unit of genetic code mRNA A C C A U G U C G A U C A GU A GC A U G GC A aa Regents Biology aa aa aa aa aa aa aa mRNA codes for proteins in triplets DNA TACGCACATTTACGTACGCGG codon mRNA ribosome AUGCGUGUAAAUGCAUGCGCC ? protein Met Arg Val Asn Codon = block of 3 mRNA bases Regents Biology Ala The mRNA code For ALL life! strongest support for a common origin for all life Code has duplicates several codons for each amino acid mutation insurance! Start codon AUG methionine Stop codons UGA, Regents Biology UAA, UAG How are the codons matched to amino acids? TACGCACATTTACGTACGCGG DNA mRNA AUGCGUGUAAAUGCAUGCGCC codon tRNA amino acid UAC Met GCA Arg CAU anti-codon Val Translation Video Anti-codon = block of 3 tRNA bases Regents Biology mRNA to protein = Translation The working instructions mRNA The reader ribosome The transporter transfer RNA (tRNA) ribosome mRNA A C C A U G U C G A U C A GU A GC A U G GC A U GG tRNA aa aa aa Regents Biology U A C tRNA aa A G C tRNA U A G aa tRNA aa From gene to protein Video (3min) aa aa transcription DNA aa translation protein aa mRNA aa aa aa ribosome A C C A U G U C G A U C A GU A GC A U GGC A nucleus Regents Biology tRNA cytoplasm aa trait Whoops! See what happens when your genes don’t work right! Any Questions?? Regents Biology Websites Series of MANY protein synthesis Videos: Regents Biology