* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download Transcription - Kenmore Tonawanda UFSD
List of types of proteins wikipedia , lookup
Eukaryotic transcription wikipedia , lookup
Protein adsorption wikipedia , lookup
RNA polymerase II holoenzyme wikipedia , lookup
Cell-penetrating peptide wikipedia , lookup
Gel electrophoresis of nucleic acids wikipedia , lookup
Molecular cloning wikipedia , lookup
Polyadenylation wikipedia , lookup
Protein (nutrient) wikipedia , lookup
Transcriptional regulation wikipedia , lookup
Non-coding DNA wikipedia , lookup
Molecular evolution wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
Silencer (genetics) wikipedia , lookup
Bottromycin wikipedia , lookup
Proteolysis wikipedia , lookup
Protein structure prediction wikipedia , lookup
Non-coding RNA wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
Point mutation wikipedia , lookup
Amino acid synthesis wikipedia , lookup
Biochemistry wikipedia , lookup
Gene expression wikipedia , lookup
Transfer RNA wikipedia , lookup
Nucleic acid analogue wikipedia , lookup
Deoxyribozyme wikipedia , lookup
Messenger RNA wikipedia , lookup
Expanded genetic code wikipedia , lookup
Protein Synthesis DNA’s destiny! Protein Review • Long chains (POLYPEPTIDES) formed by 20 different amino acids • Protein shape is determined by DNA sequence! SO HOW DO WE GO FROM DNA TO PROTEIN?? POLYPEPTIDE MADE OF MANY AMINO ACIDS What does DNA really do? • The genes in DNA must code for something right??? So what IS IT???? • The DNA alphabet (A, T, C, G) essentially codes for amino acids – Which are the building blocks for……. PROTEINS!!!!!!!!!! What does DNA do?? Con’t…… • The order of bases in DNA contains a code for a SPECIFIC order of amino acids • The order of amino acids determines the shape and function of the protein DNA to Protein overview DNA TAKES PLACE IN NUCLEUS mRNA Ribosome “reads” mRNA TAKES PLACE IN CYTOPLASM tRNA brings proper AMINO ACIDS to ribosome as mRNA is read Amino acids are linked together to make PROTEIN that gene coded for DNA to Protein Overview: The 2 phases • PHASE 1: In the NUCLEUS – Called TRANSCRIPTION – “Transcribing” DNA to single strand of mRNA – This creates a “readable” message for ribosomes • PHASE 2: In the CYTOPLASM – Called TRANSLATION – Ribosomes “translate” the message found on the mRNA strand into amino acids – The amino acids are strung together to make the protein the gene coded for DNA to PROTEIN http://www.you tube.com/watc h?v=983lhh20r GY RNA Basics • RNA is single stranded • Contains U (uracil) instead of T (thymine) – So A binds with U in RNA • Types of RNA: – mRNA • Messenger RNA • Result of transcription • Contains a message from DNA – tRNA • Transfer RNA • Brings proper amino acid to ribosome during translation Phase 1: Transcription- Making mRNA Occurs INSIDE THE NUCLEUS 1. DNA strands separate at the bases 2. Complimentary RNA bases take their places along one of the DNA strands with the help of enzymes – – – Remember…..RNA bases are A, C, G, and U (uracil) U instead of T! This creates an mRNA strand Let’s see this in action! Phase 1: Transcription con’t… Let’s practice making mRNA from a DNA strand! DNA mRNA Strands Strand T A A A U T C G G T A A T A A A U T G C C A U T T A A mRNA is constructed using DNA IS strand UNZIPPED ONE of DNA. mRNA pairs U with A, instead of T. mRNA leaves nucleus and attaches to a ribosome in the cytoplasm Diagram of Transcription Phase 2: Translation- Making a Protein Occurs in the CYTOPLASM at a RIBOSOME 1. mRNA from transcription leaves the nucleus 2. mRNA attaches to a ribosome 3. Ribosome “reads” the message in the mRNA • • Ribosomes can only read 3 bases at a time!!! 3 mRNA bases is called a CODON. Translation con’t…. 4. Reading mRNA by ribosome signals a tRNA to bring the correct amino acid • A codon codes for 1 amino acid (LOOK AT YOUR CODON SHEET) • Ex. AUG codes for tRNA to bring Methionine 5. tRNA drops off amino acid at the ribosome Translation con’t…. 6. Ribosome “reads” the next codon to signal for the next amino acid 7. Amino acids are connected by BONDS as they are brought by tRNA 8. The last codon read is a STOP codon that means the protein is complete! Translation Diagram Forming Polypeptide Ribosome mRNA Close up of translation Let’s practice Translation! • The strand we made earlier is: • If 3 bases code for 1 amino acid, how many amino acids are coded for in our strand? 3 of course! • Using your CODON SHEET, translate the mRNA codons into 3 amino acids A U G A A U C U A mRNA Strand Translation Example A U Ribosome tRNA brings Methionine G Peptide Bond A A Ribosome tRNA brings Asparagine U C U Ribosome A tRNA brings Leucine Let’s do the whole thing together! • DNA strand: TACAAACATGGCTGATCGATT • mRNA strand AUG|UUU|GUA|CCG|ACU|AGC|UAA • Amino Acids MET-PHE-VAL-PRO-THR-SER-STOP Protein Synthesis Overview