Download Genetic analysis of a congenital nephrogenic diabetes insipidus

Genetic analysis of a congenital nephrogenic diabetes
insipidus pedigree
SHEN Yun-feng*1, LAI Xiao-yang1, XIAO Xin-lan2, LI Jing1, YU Rong1, GAO
Hui1 and ZHANG Mei-ying1.
1
Department of Endocrinology and Metabolism, The second affiliated
hospital of Nanchang university, Nanchang, Jiangxi 330006, China (Shen
YF, Lai XY, Li J, Yu R, Gao H, Zhang MY)
2
Department of Magnetic Resonance Imaging, The second affiliated
hospital of Nanchang university, Nanchang, Jiangxi 330006, China (Xiao
XL)
*Correspondence to: SHEN Yun-feng, Department of Endocrinology and
Metabolism, the second affiliated hospital of Nanchang university,
Nanchang,
Jiangxi
330006,
China
(Tel:
86-791-86296440,
86-791-86296440, E-mail: [email protected])
Words: Abstract 217
Table: 2
Figure: 3
Text 1815
Fax:
Abstract
Background: As a X-linked recessive way, AVPR2 gene mutation resulted in a
hereditary disease -- congenital nephrogenic diabetes insipidus (CNDI). We found a
suspect clinical CNDI pedigree. In order to identify the genetic etiology, we
performed the genetic analysis. Methods: The clinical features of the proband and
his family members were recorded. The laboratory tests and imaging inspections
were analyzed. The water deprivation and pituitrin loading test were performed in
the proband and his brother. The genomic DNA of all the members of the pedigree
were extracted and then PCR amplification on arginine vasopressin receptor 2
(AVPR2) gene were carried out. Sequencing in both directions was performed to
identify mutation on AVPR2 gene. Results: Both the proband and his brother were
diagnosed CNDI, meanwhile the other members of this pedigree was normal. No
severe biochemical abnormality were found in the two CNDI patients. Both the
patients had moderate urinary retention, severe megaloureter and hydronephrosis,
and mild renal insufficiency. Two mutations of AVPR2 gene were discovered in the 3rd
exon in the patients, a silent mutation L309L and a nonsense mutation R337X. The
AVPR2 gene R337X mutation was co-segregated with CNDI. R337X mutation was not
a reported mutation in Chinese Mainland. Conclusion: The AVPR2 gene R337X
mutation was also a genetic etiology of CNDI patients in Chinese Mainland.
[Key words] diabetes insipidus, nephrogeic; receptors, vasopressin; gene; mutation;
Water homeostasis is partly maintained by the action of the antidiuretic hormone
arginine vasopressin (AVP) on the collecting tubules of the kidney. Secreted by
supraoptic nucleus and paraventricular nucleus in hypothalamus, and released from
the posterior pituitary, AVP mediates its antidiuretic effect by binding to the AVP
receptor 2 (AVPR2) on the basolateral surface of the principal cells.
Congenital nephrogenic diabetes insipidus (CNDI) was a rare hereditary disease,
which caused by AVPR2 or aquaporin (AQP)-2 gene mutation. AVPR2 gene mutation,
showed as X-linked recessive inheritance, caused almost 90% of CNDI.1 AQP2 gene
mutation showed as autosomal recessive or autosomal dominant inheritance, but
only resulted in 10% of CNDI.1 AVPR2 gene encodes a 371 amino acid G
protein-coupled receptor, and consist of 3 exons.2,3 After AVP binds with AVPR2, the
AVP-AVPR2 complex activates Gs/adenylate cyclase which increases intracellular
cyclic adenosine monophosphate (cAMP).4,5 This initiates a phosphorylation cascade
that promotes translocation of the water channel, AQP2, to the apical membranes of
the renal tubules.6 Mutations of the AVPR2 gene result in impaired ability to
concentrate the urine causing polyuria and maybe mental and/or growth
retardation.7 To date, over 200 mutations in the AVPR2 gene in over 300 families
have been identified, yielding approximately 56% missense mutations, 27% small
deletions/insertions, 9% non-sense mutations and 8% large or complex
deletions.1,8-10
Here, we reported a pedigree with congenital X-linked nephrogenic diabetes insipidus.
A nonsense mutation (R337X) in the 3rd exon of the AVPR2 gene was found in the
proband and the R337X mutation co-segregated with the CNDI in this pedigree.
METHODS
Subjects
The 33-year-old male proband went into our outpatient clinic and complained
persistent polydipsia and polyuria from his infancy. Because his urine special gravity
(USG) was very low, diabetes insipidus was suspected. Then, he was hospitalized and
24 h urine volume was calculated. Next, complete physical examination, laboratory
tests and instrument inspections were done. Water deprivation and pituitrin loading
test was performed for differentiating central diabetes insipidus and nephrogenic
diabetes insipidus. All tests were also done in the proband’s brother because he had
the same symptoms as the proband. Urine routine were tested in the proband’s
parents, wife and daughter.
Informed consent was obtained from all the family members. The studies were
performed according to the Declaration of Helsinki as revised in 2000 and approved
by the corresponding ethical committees.
Identification of arginine vasopressin receptor 2 (AVPR2) gene mutation by direct
sequencing
Peripheral whole blood of all members in this pedigree was drawn to sequence the
AVPR2 gene. Genomic DNA was extracted from peripheral lymphocytes using a DNA
extraction kit (Qiagen, Duesseldorf, Germany). The coding regions of exons 1-3 and
the intron-exon boundaries of the AVPR2 gene were amplified by PCR, and primers
were shown in Table 1. Due to over 1600 bp in exon 3, the exon 3 was divided into 3a,
3b, 3c, 3d for PCR amplification. PCR products were purified using QIAquick PCR
purification columns (Qiagen, Duesseldorf, Germany), and both strands were
sequenced using a BigDye terminator cycle sequencing kit (Applied Biosystems,
Warrington, UK) according to the manufacturer’s recommendations. Reactions were
analyzed on an ABI 3100 DNA sequencer (Applied Biosystems, Warringtion, UK).
As controls, the AVPR2 gene of one hundred unrelated healthy individuals were also
sequenced.
RESULTS
Clinical profiles of this pedigree
Twenty-four hours urine volume was 11~12 L/24 h in the proband. Urine routine test
showed that USG was 1.002 and negative sugar. No abnormalities were found in
plasma glucose, blood routine, glutamic-alanine transaminase, glutamic-oxaloacetic
transaminase, serum electrolyte and plasma osmotic pressure, but the serum urine
nitrogen (8.7 mmol/L) and serum creatinine (156.1 μmol/L) were mildly elevated.
Magnetic resonance imaging (MRI) of the pituitary showed T1 high signal
disappeared, but T2 signal was normal. Magnetic resonance hydrography of the
urinary system showed bilateral megaloureter and hydronephrosis (Figure 1).
Ultrasonic inspection showed urinary retention (residual urine in bladder more than
300 ml). As listed in Table 2, the water deprivation and pituitrin loading test were
negative, which indicated the central diabetes insipidus and psychogenic polydipsia
were excluded, and then the CNDI was diagnosed. After 5 days given
hydrochlorothiazide and amiloride, 24 h urine volume of the proband was reduced to
4.5~5 L.
As shown in Figure 2, the proband’s brother was also diagnosed CNDI because of
same symptoms and inspection results. Other members in this pedigree had normal
USG and urine volume, and diabetes insipidus was excluded.
Identification of a non-sense and a silent mutation in AVPR2 gene
The 3 exons of AVPR2 gene were scanned for mutations using direct sequencing. As
shown in Figure 3, two homozygous mutations (the 1008th base A→G and the 1090th
base C→T) were found in the 3rd exon of AVPR2 gene in the proband and his brother.
The 1008th base A→G suggested a silent mutation L309L (CTA→CTG). The 1090th base
C→T suggested a termination codon TGA replaced original arginine codon CGA,
which resulted in R337X non-sense mutation. Hemizygous R337X mutation were
found in the proband’s mother and daughter. R337X mutation was co-segregated
with CNDI (Figure 2). However, R337X mutation was not found in the 100 unrelated
healthy individuals used as controls.
DISCUSSION
In this study, two patients with polydipsia, polyuria from their infancy were
diagnosed CNDI, and a X-linked recessive inherent CNDI pedigree was found. Further
AVPR2 gene analysis showed that the 1090th base C→T resulted in R337X nonsense
mutation, which was not a reported mutaion in Chinese Mainland. The R337X
nonsense mutation co-segregated with the CNDI.
CNDI patients were usually found in the infancy due to persistent polyuria, frequent
fever, severe dehydration, electrolyte imbalance, delayed growth, and mental
retardation, which was firstly described by McIlraith in 1892. Mental retardation has
long been considered an important complication of untreated NDI and assumed to
be a sequel of recurrent episodes of severe brain dehydration and cerebral edema
caused by overzealous attempts at rehydration.11 With breast milk feedings, infants
usually thrive and do not develop signs of dehydration, because human milk has a
low salt and protein content, and therefore a low renal osmolar load.12 Hence, some
patients were delayed to diagnosis in their adults. In the present study, the
33-year-old proband and his brother had the characteristics of congenital diabetes
insipidus such as persistent polyuria, repeat fever from their infancy. The proband’s
mother and daughter had negative clinical manifestation. The congenital diabetes
insipidus in this family showed X-linked recessive inheritance. Like reported in other
studies, persistent polyuria in the proband and his brother resulted in the
development of urinary retention, hydroureter, hydronephrosis, and mild renal
insufficiency.13,14 Sometimes, in some patients, large-capacity hypotonic bladder
dysfunction might require clean intermittent catheterization. Adult CNDI patients
should be trained to void regularly on behalf of assuring that the maximal urinary
bladder capacity remains within normal range.
In the present study, a silent mutation L309L and another nonsense mutation R337X
in AVPR2 gene were discovered. Among all of AVPR2 mutations, L309L is the most
common polymorphism, with a global distribution, as it can be found in different
ethnical groups, starting from South-, Central- and North-Americans, continuing
through Europeans/Caucasians to Asians, Middle-Easterners and Africans.1 R337X
was also a reported mutation,2,4,15,16 but as far as we know, it had not been
documented in the mainland of China. In this study, R337X was homozygous in the
proband and his brother, and was hemizygous in the proband’s mother and daughter.
The R337X nonsense mutation co-segregated with the CNDI in this pedigree.
Usually, defects in the AVPR2 gene have been classified as the following: (a) type-1
mutant receptors, which reach the cell surface but display impaired ligand binding
and are unable to induce normal cAMP production;17 (b) type-2 mutant receptors
with defective intracellular transport that can not reach the cell surface and are
trapped in the interior of the cell;8,18,19 (c) type-3 mutant receptors which are
inappropriately transcribed, leading to unstable mRNA, which is rapidly degraded. 20
Most of the AVPR2 mutations lead to type-2 mutant receptors.20 The non-sense
mutation R337X found in this pedigree was previously characterized and resulted in
formation of a truncated AVPR2 which showed significantly decreased cell surface
expression and significantly reduced functionality.21-23 Moreover, Morello J. and his
colleagues reported this truncated receptor was retained in the endoplasmic
reticulum and never reached the Golgi compartment, which indicating that
mis-folding provoked by the mutation did not allow the receptor protein to escape
the endoplasmic reticulum quality control system.24
Hydrochlorothiazide, amiloride and indomethacin were typical drugs which often
used to treat CNDI.25-27 Recently, aminoglycoside pretreatment was reported partially
restored the function of truncated R337X V2 vasopressin receptors.28 In addition,
other studies also discovered some high-affinity non-peptide compounds or
pharmacological chaperones could promote maturation and membrane rescue of
L44P, A294P, and R337X CNDI mutants and restore a functional AVP-dependent cAMP
signal.8,29
In conclusion, we found a CNDI pedigree with AVPR2 gene R337X nonsense mutation.
As far as we knew, it was the first reported in the CNDI patients of Chinese Mainland.
The R337X mutation was also a genetic etiology of CNDI patients in Chinese Mainland.
Identifying variations in AVPR2 in CNDI patients and confirming their functional
significance are important for accurate genetic counseling. In the near future, some
new drugs may be developed to treat CNDI.
REFERENCES
1. Spanakis E, Milord E, Gragnoli C. AVPR2 variants and mutations in nephrogenic
diabetes insipidus: review and missense mutation significance. J Cell Physiol 2008;
217: 605-617. PMID: 18726898.
2. Chen CH, Chen WY, Liu HL, Liu TT, Tsou AP, Lin CY, et al. Identification of mutations
in the arginine vasopressin receptor 2 gene causing nephrogenic diabetes insipidus in
Chinese patients. J Hum Genet 2002; 47: 66-73. PMID: 11916004.
3. Seibold A, Brabet P, Rosenthal W, Birnbaumer M. Structure and chromosomal
localization of the human antidiuretic hormone receptor gene. Am J Hum Genet 1992;
51: 1078-1083. PMID: 1415251.
4. Boson WL, Della Manna T, Damiani D, Miranda DM, Gadelha MR, Liberman B, et al.
Novel vasopressin type 2 (AVPR2) gene mutations in Brazilian nephrogenic diabetes
insipidus patients. Genet Test 2006; 10: 157-162. PMID: 17020465.
5. Morello JP, Bichet DG. Nephrogenic diabetes insipidus. Annu Rev Physiol 2001; 63:
607-630. PMID: 11181969.
6. Sadeghi H, Robertson GL, Bichet DG, Innamorati G, Birnbaumer M. Biochemical
basis of partial nephrogenic diabetes insipidus phenotypes. Mol Endocrinol 1997; 11:
1806-1813. PMID: 9369448.
7. Bichet DG, Turner M, Morin D. Vasopressin receptor mutations causing
nephrogenic diabetes insipidus. Pro Assoc Am Physicians 1998; 110: 387-394. PMID:
9756088.
8. Böselt I, Tramma D, Kalamitsou S, Niemeyer T, Nykänen P, Gräf KJ, et al. Functional
characterization of novel loss-of-function mutations in the vasopressin type 2
receptor gene causing nephrogenic diabetes insipidus. Nephrol Dial Transplant 2012;
27: 1521-1528. PMID: 21917732.
9. Schöneberg T, Schulz A, Biebermann H, Hermsdorf T, Römpler H, Sangkuhl K.
Mutant G-protein-coupled receptors as a cause of human disease. Pharmacol Ther
2004; 104: 173-206. PMID: 15556674.
10. Böselt I, Römpler H, Hermsdorf T, Thor D, Busch w, Schulz A, et al. Involvement of
the V2 vasopressin receptor in adaptation to limited water supply. PLoS One 2009; 4:
e5573. PMID: 19440390.
11. Forssman H. Is hereditary diabetes insipidus of nephrogenic type associated with
mental deficiency? Acta Psychiatr Neuro Scand 1955; 30: 577-587. PMID: 13301914.
12. Wesche D, Deen PMT, Knoers NVAM. Congenital nephrogenic diabetes insipidus:
the current state of affairs. Pediatr Nephrol 2012; 27: 2183-2204. PMID:22427315.
13. Nakada T, Miyauchi T, Sumiya H, Shimazaki J. Nonobstructive urinary tract dilation
in nephrogenic diabetes insipidus. Int Urol Nephrol 1990; 22: 419–427. PMID:
2076930.
14. Uribarri J, Kaskas M. Hereditary nephrogenic diabetes insipidus and bilateral
nonobstructive hydronephrosis. Nephron 1993; 65: 346–349. PMID: 8289981.
15. Bichet DG, Birnbaumer M, Lonergan M, et al. Nature and recurrence of AVPR2
mutations in X-linked nephrogenic diabetes insipidus. Am J Hum Genet 1994; 55:
278-286. PMID: 8037205.
16. Van Lieburg AF, Knoers NVAM, Monnens LAH. Clinical presentation and follow-up
of 30 patients with congenital nephrogenic diabetes insipidus. J Am Soc Nephrol
1999; 10: 1958-1964. PMID: 10477148.
17. Rosenthal W, Antaramian A, Gilbert S, Birnbaumer M. Nephrogenic diabetes
insipidus: a V2 vasopressin receptor unable to stimulate adenylyl cyclase. J Biol Chem
1993; 268: 13030-13033. PMID:8514744.
18. Moon S, Kim J, Shim J, Lim DJ, Cha BY, Han JH. Analysis of a novel AVPR2 mutation
in a family with nephrogenic diabetes insipidus. Int J Clin Exp Med 2011; 4: 1-9. PMID:
21394280.
19. Takahashi K, Makita N, Manaka K, Hisano M, Akioka Y, Miura K, et al. V2
vasopressin receptor (V2R) mutations in partial nephrogenic diabetes insipidus
highlight protean agonism of V2R antagonists. J Biol Chem 2012; 287: 2099-2106.
PMID: 22144672.
20. Fujiwara TM, Bichet DG. Molecular biology of hereditary diabetes insipidus. J Am
Soc Nephrol 2005; 16: 2836-2846. PMID: 16093448.
21. Oksche A, Dehe M, Schülein R, Wiesner B, Rosenthal W. Folding and cell surface
expression of the vasopressin V2 receptor: requirement of the intracellular
C-terminus. FEBS Lett 1998; 424: 57-62. PMID: 9537515.
22. Wenkert D, Schoneberg T, Merendino JJ Jr, Rodriguez Pena MS, Vinitsky R,
Goldsmith PK, et al. Functional characterization of five V2 vasopressin receptor gene
mutations. Mol Cell Endocrinol 1996; 124: 43-50. PMID: 9027323.
23. Sadeghi HM, Innamorati G, Birnbaumer M. An X-linked NDI mutation reveals a
requirement for cell surface V2R expression. Mol Endocrinol 1997; 11: 706-713.
PMID: 9171234.
24. Morello JP, Salahpour A, Petäjä-Repo UE, Laperrière A, Lonergan M, Arthus MF, et
al. Association of calnexin with wild type and mutant AVPR2 that cause nephrogenic
diabetes insipidus. Biochemistry 2001; 40: 6766-6775. PMID: 11389590.
25. Kirchlechner V, Koller DY, Seidl R, Waldhauser F. Treatment of nephrogenic
diabetes insipidus with hydrochlorothiazide and amiloride. Arch Dis Child 1999; 80:
548-552. PMID: 10332005.
26. Knoers
N,
Monnenes
LA.
Amiloride-hydrochlorothiazide
versus
indomethacin-hydrochlorothiazide in the treatment of nephrogenic diabetes
insipidus. J Pediatr 1990; 117: 499-502. PMID: 2391611.
27. Kortenoeven MLA, Li Y, Shaw S, Gaeggeler HP, Rossier BC, Wetzels JF, et al.
Amiloride blocks lithium entry through the sodium channel thereby attenuating the
resultant nephrogenic diabetes insipidus. Kidney Int 2009; 76: 44-53. PMID:
19367330.
28. Schulz A, Sangkuhl K, Lennert T, Wigger M, Price DA, Nuuja A, et al.
Aminoglycoside pretreatment partially restores the function of truncated V2
vasopressin receptors found in patients with nephrogenic diabetes insipidus. J Clin
Endocrinol Metab 2002; 87: 5247-5257. PMID: 12414899.
29. Jean-Alphonse F, Perkovska S, Frantz M, Durroux T, Méjean C, Morin D, et al.
Biased agonist pharmacochaperones of the AVP V2 receptor may treat congenital
nephrogenic diabetes insipidus. J Am Soc Nephrol 2009; 20: 2190-2203. PMID:
9729439.
Table
Table 1
Primers in 3 exons of AVPR2 gene
Exons
Forward Primer
Reverse Primer
Exon1
ACCTTGGCACTCACAGAGCCCTTTC
CTAGGGCGAGGAATCCATGCTAA
Exon2
GCCACCTTCACGCCACCGCCCAGCT
TTCCCTGAATCGTCAAACCCACTCT
Exon3a
TCTAACCAGGCCCTCTTCCCGACTC
CACGAACACCATCAGGGCAATCC
Exon3b
CGTCGCACCTATGTCACCTGGATT
TGAGGACACGCTGCTGCTGAAAGAT
Exon3c
CTGAACCCAACCTAGATCCTCCACC
GGGAGGGATTAGAAAGGCGGAGA
Exon3d
GAGGAGTGGCAGGAAAGAGGGAGCAG
CAGGTGGGTGCTGGAGGTGAGAA
Table 2
Time
Water deprivation and vasopressin test
Urine Volume
(h)
USG
(ml)
Plasma Osmolality
(mOsm/L)
Body Weight
(Kg)
1
460
1.002
297.56
48.7
2
450
1.002
298.23
48.2
3
480
1.002
296.95
47.8
4
450
1.002
296.48
47.3
5
470
1.002
298.72
46.9
6
460
1.002
293.66
46.4
7
440
1.002
295.28
45.8
8
450
1.002
294.91
45.2
Note: 5 U vasopressin subcutaneously injected in the beginning of the 7th hour.
Legend
Figure 1. The Magnetic Resonance Imaging Feature of the Proband. A-D: The MRI of
pituitary. A/B showed T1 high signal disappeared, C/D showed T2 signal were normal.
E-F: The magnetic resonance hydrography of urinary system showed megaloureter,
hydronephrosis and megacystis.
Figure 2. The CNDI pedigree with AVPR2 gene mutation. The CNDI with X-linked
recessive inheritance was segregated with R337X mutation. Black: the CNDI patients
with homozygous R337X mutation and clinical symptoms. Gray: the individuals with
heterozygous R337X mutation but no clinical symptoms. White: no clinical and
genetic abnormality.
Figure 3. The sequencing of the 3rd exon in AVPR2 gene. A: forward sequencing, the
1008th base A was substitute of G which suggested a silent mutation L309L. B:
reverse sequencing in the 1008th base. C/D: Normal forward and reverse sequencing
in the 1090th base. D: Normal reverse sequencing in R337. E: forward sequencing, the
1090th base C was substitute of T which suggested a non-sense mutation R337X. F:
reverse sequencing in the 1090th base.
Figure 1
Ⅰ
Ⅱ
Ⅲ
Figure 2
A
T
G
C
Figure 3