Download Restriction Enzymes

Restriction Enzyme Digestion
&
Southern Blotting
of DNA
Experiment Goals
• Digestion of DNA by restriction enzyme
• Analyze digested DNA by electrophoresis
• Transfer digested DNA to nitrocellulose filters
(Southern blotting).
Restriction Enzymes
• Restriction enzymes are endonucleases which catalyze
the cleavage of the phosphodiester bonds within both
strands of DNA.
• They require Mg+2 for activity and generate a 5 prime
(5') phosphate and a 3 prime (3') hydroxyl group at the
point of cleavage.
• The distinguishing feature of restriction enzymes is that
they only cut at very specific sequences of bases,
Restriction enzyme
The enzyme EcoRI cutting DNA at its recognition sequence
• Different restriction enzymes have different recognition
sequences.
• This makes it possible to create a wide variety of different gene
fragments.
Restriction Enzyme
• There are hundreds of different REs from
different microorganisms.
• Each RE cuts DNA at a specific “recognition
sequence” of nucleotides. Examples:
 EcoRI-- GAATTC;
 AluI -- AGCT
• Restriction enzymes are traditionally classified
according to the subunit composition, cleavage
position, sequence-specificity and cofactor
requirements.
Naming of Restriction enzymes
• Restriction enzymes are named according to the
organism from which they are isolated.
• This is done by using the first letter of the genus
followed by the first two letters of the species.
• Only certain strains or sub-strains of a particular
species may produce restriction enzymes.
Restriction Enzyme Uses
• Recombinant DNA technology
• Cloning
Replicates a sequence inserted into a host
cell
• DNA restriction mapping
A rough map of a DNA fragment
• DNA fingerprints
• A restriction enzyme requires a specific double stranded
recognition sequence of nucleotides to cut DNA.
• Recognition sites are usually 4 to 8 base pairs in length.
• Cleavage occurs within or near the site.
• Both DNA strands in the site have the same base
sequence when read 5' to 3'. Such sequences are called
palindromes.
HinfI Restriction Enzyme
• Recognition Site:
• Restriction enzyme is part of the cell’s
restriction-modification system in bacteria.
• The phenomenon of restriction modification in
bacteria is a small scale immune system for
protection from infection by foreign DNA.
• Bacteria can protect themselves only after foreign
DNA has entered their cytoplasm.
Unit Determination Assay
• One unit of restriction endonuclease is defined
as the amount of enzyme required to digest
one microgram of the appropriate substrate
DNA completely in 60 minutes under the
conditions specified for that enzyme.
Set up of a restriction enzyme reaction
• A RE reaction contains the DNA to be
analyzed,
• A restriction enzyme,
• A restriction enzyme buffer mix.
– contains a buffering agent to maintain
constant pH,
– and Mg++ (from MgCl2) as a necessary
cofactor for enzyme activity.
Digestion by Restriction Enzyme
• Measure the DNA concentration
– Use the Nano-drop spectrophotometer to measure
the concentration of DNA, this is used to determine
the amount of HinfI restriction enzyme to be used.
Digestion of DNA
• Mix the following components in a clean microtube.
• Mix gently and spin down for a few seconds.
• Incubate at 37°C for 16 hours.
Analysis of DNA digestion
• Analyze products on 2% agarose gel containing
ethidium bromide.
• Samples are prepared with loading dye and then
loaded on the gel.
• Visualize the PCR product on UV transilluminator.
Electrophoresis of Genomic DNA
Odd numbered lanes contain undigested genomic DNA
Even numbered lanes contain digested genomic DNA
Undigested DNA is represented by a sharp band near the wells of the gel, while
smearing indicates digested DNA sample.
Southern Blotting
Southern Blotting
• A technique used in molecular biology to check
for the presence of a particular DNA sequence
in a DNA sample.
• The amount of DNA needed for this technique
is dependent on the size and specific activity of
the probe.
Uses of Southern Blotting
• Identify mutations, deletions, and gene
rearrangements
• Used in prognosis of cancer and in prenatal
diagnosis of genetic diseases
• Diagnosis of Leukemia's
• Detect variations in gene structure
• Identify homologous genes among different
species
Principle
• The Southern Blot takes advantage of the fact
that DNA fragments will stick to a nylon or
nitrocellulose membrane.
• DNA molecules are first elctrophoresed and then
transferred from an agarose gel onto a membrane.
• The membrane is laid on top of the agarose gel
and absorbent material (e.g. paper towels or a
sponge) is placed on top.
• With time, the DNA fragments will travel from
the gel to the membrane by capillary action as
surrounding liquid is drawn up to the
absorbent material on top.
• The membrane is now a mirror image of the
agarose gel.
Performing Southern Blotting
1.
DNA Digestion with an appropriate restriction enzyme.
2.
Gel Electrophoresis run the digest on an agarose gel.
3.
Denature the DNA (usually while it is still on the gel).
4.
Transfer the denatured DNA to the membrane (blotting)
5.
Preparing the probe
6.
Hybridization Probe the membrane with labeled ssDNA.
7.
Detection Visualize your radioactively labeled target sequence.
1- DNA Digestion
• Cut the DNA into different sized pieces.
• HinfI restriction enzyme is used.
2- Gel Electrophoresis
• Load digested samples onto agarose gel
(typically 0.8 to 1.0% agarose).
• Run gel at maximum rate of 5 volts per cm.
3- Denature the DNA
• DNA is then denatured with an alkaline
solution such as NaOH.
• This causes the double stranded to become
single-stranded.
• Only ssDNA can transfer.
4- Blotting
• Transfer the DNA from the gel to a solid
support.
• The blot is usually done on a sheet of
nitrocellulose paper or nylon (a positively
charged nylon membrane ).
• Transferred by either electrophoresis or
capillary blotting.
4- Blot Fixation
• The blot is made permanent (constant) by:
– Drying at ~80°C
– Exposing to UV irradiation
5- Preparing the probe
• It is a fragment of DNA of variable length
(usually 100-1000 bases long), which is used to
detect in DNA the presence of nucleotide
sequences that are complementary to the
sequence in the probe
• Must be labeled to be visualized
• Usually prepared by making a radioactive copy
of a DNA fragment.
• Probing is often done with 32P labeled ATP,
biotin/streptavidin or a bioluminescent probe.
6- Hybridization
• Hybridization-process of forming a doublestranded DNA molecule between a singlestranded DNA probe and a single-stranded
target patient DNA.
6- Hybridization
• Steps for hybridization
1. The labeled probe is added to the matrix
incubated for several hours to allow the
probe molecules to find their targets
2. Any unbound probes are then removed.
3. The place where the probe is connected
corresponds to the location of the
immobilized target molecule.
probes
add probe 3’ –
*ATCTCGGGAATC – 5’
hybridization
5’ – …AAGCCTAGAGCCCTTAGCCAAAAG… – 3’
* ATCTCGGGAATC
7- Detection
Visualize your labeled target sequence.
• If radiolabeled 32P probe is used, then you
would visualize by autoradiography.
• Biotin/streptavidin detection is done by
colorimetric methods.
Steps in Southern Blotting
DNA
extraction
Disease gene
Fragments of
DNA appear
as a smear
DNA digestion
Gel electrophoresis
Blot dismantled
Paper towels
Chromatography
paper support
Nylon filter
Gel
10x SSC
Denaturation of patient’s DNA in gel
Gel in
NaOH
Southern blot
Autoradiography
X ray film
Hybridisation:
Stringency washes
Radioactive probe
added to filter
filter
cassette
filter
Southern Blot of same DNA (final result on x-ray film)
Animation
• http://highered.mcgrawhill.com/sites/9834092339/student_view0/chapter17/restriction_endonuclea
ses.html
• http://www.dnatube.com/video/11736/Restriction-Enzyme-EcoR1
• http://www.dnatube.com/video/11813/Restriction-Enzyme-Digestion
• http://www.dnatube.com/video/11696/Restriction-enzyme-action-of-EcoRI
• http://highered.mcgrawhill.com/sites/9834092339/student_view0/chapter17/dna_probe__dna_hybr
idization_.html
• http://www.dnatube.com/video/1512/Southern-blot