* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download Academic Biology
Quantitative trait locus wikipedia , lookup
DNA vaccination wikipedia , lookup
Non-coding RNA wikipedia , lookup
Nucleic acid tertiary structure wikipedia , lookup
No-SCAR (Scarless Cas9 Assisted Recombineering) Genome Editing wikipedia , lookup
Polymorphism (biology) wikipedia , lookup
X-inactivation wikipedia , lookup
Epigenomics wikipedia , lookup
Molecular cloning wikipedia , lookup
Genealogical DNA test wikipedia , lookup
Site-specific recombinase technology wikipedia , lookup
Genome (book) wikipedia , lookup
History of RNA biology wikipedia , lookup
Genetic engineering wikipedia , lookup
Nucleic acid double helix wikipedia , lookup
DNA supercoil wikipedia , lookup
Cell-free fetal DNA wikipedia , lookup
Genetic code wikipedia , lookup
Non-coding DNA wikipedia , lookup
Designer baby wikipedia , lookup
Extrachromosomal DNA wikipedia , lookup
Therapeutic gene modulation wikipedia , lookup
Koinophilia wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
Primary transcript wikipedia , lookup
Dominance (genetics) wikipedia , lookup
Helitron (biology) wikipedia , lookup
Population genetics wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
History of genetic engineering wikipedia , lookup
Point mutation wikipedia , lookup
Nucleic acid analogue wikipedia , lookup
Name_________________________ 2016-Biology Final Exam STUDY GUIDE Chapter 10 - Cell Growth and Division Describe why cells divide instead of growing larger o Surface area:Volume ratio-Problem:______________________________________ o What is the purpose of cell division: ______________________________________________________________________________ ______________________________________________________________________ Describe the relationship between chromatin, chromosomes, sister chromatids, and centromeres o Chromatin: o Chromosomes: o Sister chromatids: o Centromere: Define mitosis and cytokinesis o Mitosis: Four phases: o Cytokinesis: Describe the role of the centrioles and the spindle o Spindle: o Centrioles: Describe what happens at each phase of the cell cycle & be able to recognize pictures of interphase, prophase, metaphase, anaphase, and telophase Interhase Anaphase Prophase Telophase Metaphase Cytokinesis Describe what happens when a cell cannot control its rate of division o When a cell cannot control its rate of division, this is known as:__________________ o Caused by ________________________ Chapter 11 – Introduction to Genetics Genetic terms ( give Examples) o Heterozygous o Homozygous o Hybrid o Allele o Trait o Phenotype o Genotype Define meiosis and explain why we need it to occur o Meiosis: o Involves 2 divisions: o Need to occur so _______________________________cells can be made each one unique from other o ______________________ are produced Define homologous chromosomes Distinguish between diploid cells and haploid cells o Diploid: o Haploid: Describe crossing over o Crossing-over: o Takes place during: Describe the end result of meiosis o Discuss how meiosis increases genetic variation o Describe the similarities and differences between mitosis and meiosis o Differences o Similarities Describe Mendel’s conclusions (principle of dominance, principle of segregation, principle of independent assortment) o ________________________: states that some alleles of dominant and others recessive, e.g., an allele for tallness from the tall parent and an allele for shortness from the short parent o ________________________: genes for different traits can segregate independently during the formation of gametes o ________________________:separation of alleles during gamete formation o Used pea plants to study inheritance of traits Know how to determine genotype and phenotype Genotype: 1. example Phenotype: 1. example: Distinguish between heterozygous and homozygous genotypes Heterozygous example: Homozygous example: Punnett squares use mathematical probability to help predict genotype/phenotype combinations in genetic crosses Know how to work through a Punnett square problem (1 factor cross – 4 squares) Example G = Green g= yellow -phenotype ratio (green:yellow)_________________ genotype ratio (GG:Gg:gg)______________________ G G g g Describe inheritance patterns that exist aside from simple dominance incomplete dominance multiple alleles codominance polyenic traits Be able to work Punnett square problems for incomplete dominance, multiple alleles, and codominance Chapter 12 & 13 – DNA and RNA o Key Roles of DNA: Describe the contributions of scientist ; ________________________________________Built 3D molecular model of the Double Helix ________________________________________’s x-ray diffraction image of DNA was used to determine the physical structure of DNA Describe the overall structure of the DNA molecule o Chemical components of DNA: nucleic acid made up of __________________________ Nucleotides: build blocks of nucleic acids which are made up of: 5-carbon sugar called _____________________, a phosphate group, a nitrogenous base (______________,________________,___________, or___________________) o Double-helix model Explains Chargaff’s rule of base pairing and how 2 strands of DNA are held together Observation proved rule that [A]=[____] and [G]=[_____] Tells how DNA can function as genetic carrier o ____________________________ bonds form between bases of opposite strands, providing enough force to hold 2 bases together but weak enough to be broken during replication Summarize the events of DNA replication o Process of Replication 1. 2. 3. RNA o Contains the base __________and the sugar___________________ Describe the differences between DNA and RNA o Sugar in RNA is ______________________in DNA it is deoxyribose o RNA is ______________________________and DNA is double-stranded o RNA contains uracil in place of DNA’s thymine Describe the similarities in both DNA and RNA o o Describe the function of the 3 types of RNA o _____________________________: carries instructions for polypeptide synthesis from nucleus to ribosomes in the cytoplasm (single stranded) o ______________________________: forms an important part of both subunits of the ribosomes where proteins are assembled o ______________________________: carries amino acids to ribosome and matches them to the coded mRNA message Protein Synthesis – involves messenger RNA, Protein ribosomal RNA, and transfer RNA o Transcription Describe what happens: What is produced at the end?__________________________________________ o Translation Describe what happens: What is produced at the end?__________________________________________ o Amino Acid: building blocks of proteins _______________________: long chain of amino acids that makes proteins. Protein: formed from Polypeptide & determine appearance & function of cell & organism Example: DNA sequence: TACCGTCTCGTATTGTACGCTGCAACT Transcribe: Translate: Describe the different types of mutations and how they affect the amino acid sequence o ______________________________– involves a single nucleotide mutation Affect one nucleotide or a few nucleotide Include substitutions, insertions, and deletions Substitutions: one base is replaced by another. Changes only one amino acid ________________________mutations Involves the deletion or the insertion of a base Remember sequence read in groups of three so when you add or delete a base, change “reading frame” of the genetic message Changing every amino acid after that point o Chromosomal mutations:_______________________________________________________ Inversion Deletion Duplication Tranlocation Chapter 14 – The Human Genome Know how to read pedigrees and determine pattern of inheritance and genotypes of individuals from info given Define karyotype and distinguish between sex chromosome and autosomes o Karyotype: _________________________________________________________________ o Sex Chromosome: ______________________________________________________________ o Autosome: ___________________________________________________________________ Explain how sex is determined o Sex Chromosomes: 46,XX, female/ 46,XY, male o Females have ____copies of the X chromosome; males have one X and one Y chromosome o Probability of a human sperm will carry an X chromosome is __________ Know Human blood type genotypes and phenotypes o Sample problem: A woman with type A blood marries a man with AB blood type. What are the possible blood type for their children if the woman is homozygous for her type A blood. Draw punnett square, state genotypic and phenotypic ratios Sex-linked genes: _____________________________________________________________ Describe some sex-linked disorders and explain why they are more common in males than in females o o o Male only receives sex-linked alleles from his_________________ o Male needs _____ copy of the sex-linked allele to exhibit the recessive trait o Female must inherit _________recessive alleles – one from each parent – to exhibit the trait o -Sample problem: A woman with normal vision who’s father was colorblind wants to have children with a man with normal vision. Do a punnet square to show the cross and the possible genotypes and phenotypes of their children. Define nondisjunction and explain how it results in chromosomal disorders o Nondisjunction: down syndrome turner’s syndrome klinefelter’s syndrome Chapter 16 - Evolution Artificial Selection vs. Natural selection Explain how natural selection is related to species’ fitness 1. Fitness: Adaptations suited to environment (increase/decrease) fitness Adaptations not suited to environment die/low offspring (increase/decrease) fitness Survival of the fittest: Support for theory of evolution Fossil Record All fossil evidence, taken together, shows how organisms have changed Shows how organisms change over time, in timeline Many recently discovered fossils form series that trace the evolution of modern species from extinct ancestors Challenging: missing species, knowing which ones related to each other, but so different, confuse similar organisms with each other, use bones: which could decay & don’t know everything about organism from bones Anatomy _________________________: structures in related organisms that have been inherited from common ancestor Evolutionary theory explains the existence of these adapted to different purposes as result of descent with modification from common ancestor ____________________________: structure that is inherited from ancestors but is no longer used and reduced in size (support not by Darwin) Example:_______________________________________________ Embryology Vertebrate embryos show similar pattern of development Patterns of embryological development provide further evidence that organisms have descended from common ancestor Molecular Biology All living things share the same basic DNA The more DNA in common, the ___________ closely related 2 things are Approximate 98.8% of DNA is same in humans and chimps At molecular level, universal genetic code & homologous molecules provide evidence of common decent to trace evolution Homologous vs. Analogous structures Geographic distribution Artificial Selection Natural Selection in action – for example antibiotic resistanct, pesticide resistance State Darwin’s theory of evolution by natural selection : Chapter 17 – Evolution of Populations Explain the term gene pool o Gene pool: Identify the main sources of inheritable variation in a population o __________________________________ Produce changes in phenotype affect fitness If cause genetic diseases=lethal, lower fitness by decreasing individual’s ability to survive & reproduce or increase this o Genetic Recombination in Sexual Reproduction:____________________________ Chromosomes sort independently Heritable differences are due not to mutation but to genetic recombination or “gene shuffling” ________________________during meiosis I Paired chromosomes swap lengths of DNA at random during meiosis Increases # of new genotypes created in each generation Members of species different one and other ending up with traits from both parents Explain how natural selection affects single-gene and polygenic traits o Selection on Single gene traits Lead to changes in allele frequencies and to changes in phenotype frequencies o Selection on ______________________ traits Affect relative fitness of phenotypes and produce one of 3 types of selection __________________________: form of natural selection in which individuals at one end of distribution curve have higher fitness than individuals near middle of curve ________________________: form of natural selection in which individuals near center of distribution curve have higher fitness than individuals at either end of curve ________________________: __________________________________________________________________ __________________________________________________________________ Describe speciation; define species o Species: o Speciation: Describe reproductive isolation and describe the three isolating mechanisms o Reproductive isolation: 1. _______________________________ Courtship, mating, what attracts them, behaviors 2. _________________________________ 3. Temporal Isolation Define allele frequency and calculate allele frequency o Allele frequency: Chapter 19 – History of Life The Fossil Record The Fossil Record shows the structure of ancient organisms, their environment and lived and are now extinct. Most sedimentary rocks form when sediments settle to the bottom of a body of water. Radiometric Dating uses the proportion of radioactive isotopes to find the absolute age of a sample. Chapter 18 – Classification Explain how living things are organized to study o What is taxonomy? a taxon? o Kingdom, phylum, class, order, family, genus, species o binomial nomenclature o What is a cladogram? How do you find common ancestry? CELL PROCESSES, STRUCTURE, FUNCTION, TRANSPORT Explain difference between passive vs. active transport Define Osmosis Isotonic Hypertonic Hypotonic Cell Parts function Ribosome Nucleus Cell membrane Chloroplast Mitochondria Difference between eukaryotic vs. prokaryotic Difference between plant vs. animal cell