Download BIOTECHNOLOGY AND GENETIC ENGINEERING

MODERN GENETICS
What is Cloning?
 Making an exact genetic copy
of a cell, organ or an organism
 This process uses SOMATIC
CELLS (non-sex cells) instead
of sex cells because somatic
cells contain a complete set of
chromosomes (46).
Basics of the Cloning Procedure
Somatic Cell Nuclear Transfer
 This happens in vitro (outside the
body).
 The nucleus of a somatic cell is
placed inside an egg cell that has had
its nucleus removed.
 Electricity sparks cell division of the
egg cell and an embryo is formed.
Basics of the Cloning Procedure
 An embryo is the form of the
organism in its early stages. It is a
group of undifferentiated cells.
 The embryo is placed in the uterus of
the egg donor or surrogate mother.
 A surrogate mother is a female who
carries the baby for another female.
Let’s Draw the Cloning
Process!
HISTORY OF CLONING
 1953
 1996
 1998
 2001
 2002
 2002
 2003
 2005
frog
sheep
cow
rabbit
rat
cat
horse
dog
Cloning does not always
produce expected results. It is
also expensive and inefficient!
 CC the cat cost $50,000 to create. Her
genetics were the same as her clone,
however she did not appear identical!
Why?
 Horse- 841 attempts = .12% efficiency
 Sheep- 277 attempts = .36% efficiency
RainbowParent Clone
CC- Copy Cat
Cloning Pros/Cons
Pros
Cons
 Can clone organs for
transplant patients.
 Can help infertile couples
have offspring genetically
linked to one of the
parents.
 Can increase populations
of endangered species.
 Can bring back a
deceased pet.
 Can replicate living things
with desirable traits- like
trees that grow quickly.
 Does not help to improve
the genetic diversity of a
species.
 Could create a black
market for transplant
organs-Create clones to
harvest organs!
 Expensive and inefficient!
STEM CELL RESEARCH
 What is a stem cell?
 A cell that is not yet
differentiated into a
specific type.
 What’s so special
about embryonic
stem cells?
 They are Pluripotent
 can become any of the
220 different cell types
Why is the use of
embryonic stem cells so
controversial?
 Removing a stem cell from an
embryo for experimentation
destroys the embryo.
 Is this murder?
 When does life begin?
 Read and discuss “Embryos R Us
Case Study”
Therapeutic potential
Turn the stem cells into:
Pancreas cells to produce
insulin to relieve diabetes
Dopamine producing cells in
the brain to relieve
Parkinson’s disease
New limbs and failing organs
Is it controversial to
experiment on all stem cells?
 In addition to embryonic stem cells, there are
adult stem cells.
 Adult stem cells are found in many organs and
tissues, including brain, bone marrow, blood
and skin.
 These stem cells are multipotent which means
they can only become a certain type of cell(s) .
 Their purpose is to maintain and repair the
tissue in which they are found.
Is it controversial to
experiment on all stem cells?
 Experimenting with adult stem cells is not
controversial because it does not harm the
adult if the cells are removed from the body.
 There has been some exciting recent research
that has demonstrated the ability to turn adult
stem cells into embryo-like stem cells. These
are called “induced pluripotent stem cells”
(IPSCs).
Genetic Engineering
 gene- DNA sequence that codes for a
protein.
AATCGTAACCGGTTA
 genome -all the possible bases in a
species or individual
 Human Genome Project (1990-2003) - All
of the base pairs in the human genome
have been sequenced (locations of
genes on the 23 chromosomes have
been determined). The human genome
has approximately 20, 500 genes.
What is Genetic Engineering?
 The modification of the DNA in an organism or
the exchange of DNA between organisms.
 Why would we want to do this?
 Genetic engineering can happen between
different species because the DNA code is
universal. All living things have ACGT
nucleotides and the same amino acid coding
scheme.
 AUG codes for methionine in all living things!
Steps to Genetic Engineering
 1. A gene of interest is removed
from a genome.
 2. The gene is attached to a vector
(transporter) and delivered into a
host cell
 3. The host cell is put into a nutrient
medium and allowed to divide many
times to create many copies of the
gene.
 4. The host cell is inserted into the
organism.
How is a gene removed from
a genome?
 Restriction enzymes- recognize a
specific DNA sequence and cut the DNA
wherever that sequence exists.
ATCGGATGAATTCTACCGATTAAG
TAGCCATCTTAAGATGGCTAATTC
How is the gene of
interest separated from
other genes?
 Gel electrophoresis
Gel Elecrophoresis
 DNA samples are placed in a porous gel
which is connected to an electric current.
 The current moves the DNA pieces and
separates them based on their size. The
smallest pieces move the fastest and end up
at the bottom.
 We can use this technique to isolate genes,
determine genetic relationships (paternity),
determine evolutionary relationships, and
solve crimes.
What is a common vector
used in genetic engineering?
 Plasmids are circular DNA molecules
found in bacteria that are often used for
genetic engineering.
 The plasmid is cut with the same
restriction enzyme used to cut out the
gene of interest.
 Once the plasmid has the new gene, it
is called recombinant DNA.
Gene Therapy
 Humans can be genetically engineered.
 Normal genes can be inserted into cells
containing defective genes in order to
correct genetic disorders.
Gene Therapy
Paternity Testing
If there is uncertainty about a child’s biological
father, DNA samples from the possible fathers
can be compared with the DNA of the child and
mother.
All DNA samples are treated with the same
restriction enzyme and are run on a gel by
electrophoresis.
A child’s DNA pieces are a combination of
pieces from the mother and father (each DNA
band must match a band from one parent).
DNA Fingerprinting to determine Paternity
Who is the
father?
• Circle the
smallest DNA
fragment(s).
• Box the largest
DNA
fragment(s).
A=father
B=mother
Are C and D
both biological
children of A
and B?
Genetics Technology Bingo
1. Cloning
2. Induced pluripotent stem
cells
3. Embryo
4. Multipotent
5. Surrogate
6. Technology
7. Gel electrophoresis
8. Plasmid
9. Adult stem cell
10. Genetic engineering
11. Electricity
12. Restriction enzyme
13. Gene therapy
14. Genome
15. Gene
16. Recombinant DNA
17. In vitro
18. Somatic cell
19. Somatic cell nuclear
transfer
20. Vector
21. Uterus
22. X-inactivation
23. Embryonic stem cell
24. Pluripotent
 Biotechnology Test Review Questions:
 Easy
 Small, circular piece of bacterial DNA is called a ____.
 Give two examples of vectors:
 The entire collection of genes within human cells is called
the _______________.
 Difference between technology and biotechnology?
 Function of restriction enzymes?
 HGP stands for? How many base pairs in HG? How
many proteins?
 Difference between surrogate and biological mother?
 A _____________ is caused by a defective or mutant
gene.
 Define gene.
 The first cell created by sexual reproduction is called a
 Medium
 1. Inserting unrelated pieces of DNA together will
result in ____________________.
 2. IVF stands for? What is a synonym used for
IVF?
 3. What does transgenic mean?
 4. Idenical twins are considered to be genetic
___________.
 5. How does IVF work? What does the female
have to do? What does the male have to do?
 6. Why does IVF sometimes result in twins, triplets,
or quads?
 7. Difference between fraternal vs. identical twins?
 8. How does Gel Electrophoresis separate DNA
fragments?
 9. What is an example of a genetic disease?
 10. What kind of ethical questions arise from IVF?
 Difficult
 What is the difference between gene therapy and
genetic engineering?
 Difference between a hybrid and chimera?
 Steps of genetic engineering?
 The Hind R1 restriction enzyme is used to slice
DNA at the GAATTC between the G and A.
Illustrate how this enzyme would precisely cut the
fragment:
 ATTAGATCGCCCTAGAATTCAAGCTGGTAGCTAGCTACATCTA
 TAATCTAGAGGGATCTTAAGTTCGACCATCGATCGATGTAGAT
 What research can be done using gel
electrophoresis?