Download Automation of genomic DNA isolation from formalin

Pathology – Research and Practice 208 (2012) 705–707
Contents lists available at SciVerse ScienceDirect
Pathology – Research and Practice
journal homepage: www.elsevier.com/locate/prp
Original article
Automation of genomic DNA isolation from formalin-fixed, paraffin-embedded
tissues
Soya S. Sam a , Kimberly A. Lebel b , Cheryl L. Bissaillon b , Laura J. Tafe a , Gregory J. Tsongalis a ,
Joel A. Lefferts a,∗
a
b
Department of Pathology, Dartmouth-Hitchcock Medical Center, Lebanon, NH, United States
Department of Pathology, Baystate Health Center, Springfield, MA, United States
a r t i c l e
i n f o
Article history:
Received 13 July 2012
Received in revised form 7 August 2012
Accepted 17 August 2012
Keywords:
FFPE tissue
DNA isolation
Qiagen EZ1 Tissue Kit
Real-time PCR
a b s t r a c t
Isolation of DNA from formalin-fixed, paraffin-embedded (FFPE) tissue remains a laborious task for clinical laboratories and researchers who need to screen several samples for genetic variants. The objective
of this study was to evaluate DNA isolation methods from FFPE tissues and to choose an efficient method
with less hands-on time to obtain DNA of optimum concentration and purity for use in routine molecular diagnostic assays. Three methods were compared in this study: Gentra Puregene Tissue Kit, EZ1
DNA Tissue Kit and QIAamp FFPE Tissue Kit. Samples consisted of FFPE tissues of head/neck and lung
tumor resections. Quality control for the extraction process end product included determination of the
concentration and purity of isolated DNA and the ability to amplify a housekeeping gene, GAPDH, using
real-time PCR assay. The hands-on-time required was less for the EZ1 protocol compared to the other
methods. The average DNA concentration obtained was 112, 61 and 40 ng/␮l, respectively, for the Gentra
Puregene Tissue Kit, Qiagen EZ1 DNA Tissue Kit and QIAamp FFPE Tissue Kit. The purity and quality of
samples obtained using the different DNA isolation methods were comparable. Comparative evaluation
of three DNA isolation methods indicated that the Qiagen EZ1 method surpassed the other methods with
reduced hands-on-time to produce optimum concentration of quality DNA for use in routine molecular
analyses.
© 2012 Elsevier GmbH. All rights reserved.
Introduction
With the advent of molecular profiling technologies, there are
tremendous opportunities to screen and comprehensively evaluate
biomarkers and unlock the molecular mechanisms pertaining to
various diseases. Worldwide, millions of FFPE tissues are archived
in hospitals and tissue banks, and these tissues represent a rich
source of information on genetic events involved in different
aspects of clinical conditions [1]. Formalin fixation and paraffinembedding have been the clinical standard for preserving these
valuable samples [2,3]. FFPE tissues have several advantages over
fresh or frozen tissue samples in that it is easy to handle and has
inexpensive long-term storage [4].
Though FFPE tissue is often the only choice for clinical molecular
applications, isolation of DNA from FFPE tissues is challenging. The fixation of tissues causes modifications and consequent
cross-linkage of biomolecules by formaldehyde, a principal active
∗ Corresponding author at: Department of Pathology, Dartmouth-Hitchcock Medical Center, One Medical Center Drive, Lebanon, NH 03756, United States.
Tel.: +1 603 650 8116.
E-mail address: [email protected] (J.A. Lefferts).
0344-0338/$ – see front matter © 2012 Elsevier GmbH. All rights reserved.
http://dx.doi.org/10.1016/j.prp.2012.08.008
component of formalin. The nucleic acids tend to undergo degradation in an extremely acidic environment which, in turn, affects the
downstream applications [1,5,6]. Moreover, the extraction of DNA
from these samples remains a challenge for clinical laboratories
and researchers screening multiple samples for genetic variants as
conventional extraction procedures are very laborious and timeconsuming for processing of samples in a busy clinical laboratory
setting. Nevertheless, FFPE tissue archives constitute a resource for
retrospective biomarker discovery from which valuable epidemiological data on several diseases could be elucidated [7].
Therefore, the objective of this study was to develop an efficient
method with less hands-on time to obtain DNA of optimum concentration and purity from FFPE tissues, for use in routine downstream
applications. The three different Qiagen isolation methods that
were tested were the Gentra Puregene tissue isolation method
(manual), EZ1 DNA Tissue Kit (automated isolation with upfront
processing) and QIAamp DNA FFPE Tissue Kit (manual spin column).
Materials and methods
Five tissue samples were randomly selected that included
three head/neck (floor of the mouth/left lateral tongue/bilateral
706
S.S. Sam et al. / Pathology – Research and Practice 208 (2012) 705–707
neck dissection) and two lung (right and left upper lobes) tumor
resections. For all experiments, we used FFPE tissue rolls (two
consecutive 10 ␮m thick sections) and unstained slides (four consecutive 5 ␮m thick sections) obtained from the paraffin blocks
of the tumor tissues. The tissue rolls were collected in 1.5 ml
micro-centrifuge tubes (USA Scientific, FL, USA), and the unstained
sections from slides were scraped using a sterile scalpel blade (BD
Bard-ParkerTM , no. 11) and collected into micro-centrifuge tubes
that contained appropriate deparaffinizing or lysis buffer depending on the method.
Qiagen Gentra Puregene tissue isolation method
This protocol initially uses xylene to remove the paraffin from
the tissues which include several steps of incubation, centrifugation
and removal of supernatant without disturbing the pellet. This was
followed by ethanol wash using absolute and 95% ethanol where
similar steps were followed as above. Cell lysis solution was added
to the pellet, followed by addition of proteinase K and incubated
overnight at 56 ◦ C. To the completely digested tissue lysate, we
added RNase A Solution and protein precipitation solution. The
supernatant obtained on spinning down the samples was added
to a tube containing isopropanol and mixed by inverting gently
about 50 times. The DNA pellet was washed by adding 70% ethanol
and inverting several times. After final centrifugation and removing
the supernatant, the tubes were air-dried for evaporation of residual ethanol. DNA hydration solution was added and vortexed for
5 s followed by incubation at 65 ◦ C for 1 h to dissolve the DNA.
EZ1 DNA Tissue Kit isolation method
Isolation of DNA using the Qiagen EZ1 DNA Tissue Kit was performed according to the manufacturer’s instructions with minor
modifications. Completely submerged tissues sections in 180 ␮l
of extraction buffer, G2, were incubated for 5 min at 75 ◦ C with
vigorous mixing (500 rpm) on a thermomixer. The temperature
of thermomixer was lowered to 56 ◦ C and allowed the samples
to cool to 56 ◦ C. Proteinase K was added and incubated at 56 ◦ C
overnight. Additional proteinase K was added, and the incubation
was continued for 2 h the next morning. The samples were centrifuged and homogenized by pipetting up and down a few times.
After centrifuging the samples once more, the supernatant was
transferred to new sample tubes and subjected to automated DNA
isolation on a BioRobot EZ1 workstation (Qiagen) equipped with a
DNA Paraffin Section card and EZ1 DNA Tissue Kit cartridges.
QIAamp FFPE Tissue Kit isolation method
The protocol was performed according to the manufacturer’s
instructions with certain modifications. The initial part of the protocol was similar to Gentra Puregene isolation technique, where
xylene deparaffinization and ethanol wash was adopted. After
removing the residual ethanol, the pellet was resuspended in buffer
ATL followed by addition of proteinase K and incubated at 56 ◦ C
overnight. On the following morning, additional proteinase K was
added and the incubation was continued for 2 h. The completely
lysed samples were then incubated at 90 ◦ C for 1 h in order to
reverse formaldehyde cross-linking. After a brief centrifugation of
the lysate tubes, RNase A was added and incubated for 2 min at
room temperature. Buffer AL and 95% ethanol were added to the
samples and vortexed thoroughly. Whole lysate was then transferred to QIAamp MinElute column placed in a 2 ml collection tube.
This was centrifuged and the QIAamp MinElute column was placed
into a clean 2 ml collection tube. Buffer AW1 was added to the
column, centrifuged, and the column was placed in a clean 2 ml collection tube. This step was repeated using AW2 buffer as well. After
centrifuging, the column was placed in a 1.5 ml tube, and Buffer ATE
was added to the center of the membrane. After incubating at room
temperature for 1 min, the samples were centrifuged and the DNA
was collected into the tubes.
Evaluation of DNA samples
The volume of DNA eluted from all the three methods was 50 ␮l.
The total amount of DNA from three purification methods was
determined by measuring the absorbance at 260 nm (A260 ), and
the purity was assessed by calculating the A260 /A280 ratio using
the Nanodrop 1000 spectrophotometer (Thermo Scientific, Rockford, IL). Further, the DNA concentrations of the samples were
normalized to 10 ng/␮l, and real-time PCR was performed for a
housekeeping gene, GAPDH, using the Applied Biosystems 7500
Fast real-time PCR system. The reaction was carried out using SYBR
GREEN master mix (Applied Biosystems) containing AmpliTaq Gold
polymerase in a standard PCR buffer. The sequences for forward and
reverse primers of GAPDH were TCTCTGCTGTAGGCTCATTTGCAG
and CATGGTTCACACCCATGACGAACA. The thermocycling conditions were as follows: initial denaturation at 95 ◦ C for 15 min,
followed by 45 cycles of denaturation at 94 ◦ C for 15 s, annealing
at 55 ◦ C for 30 s and extension at 72 ◦ C for 30 s.
Results
Purification of DNA spanned two days for all the three methods
tested in the study. Hands-on-time was lowest for the EZ1 protocol
(as little as 10 min) compared to the QIAamp FFPE DNA Tissue Kit
(45 min) and Gentra Puregene Tissue Kit (3 h). The Gentra Puregene
protocol yielded the most DNA followed by the EZ1 method while
the QIAamp method produced relatively lower yield with average
concentrations of 112, 61 and 40 ng/␮l, respectively. The purity was
comparable for all the samples isolated using the three protocols
with average A260 /A280 ratios between 1.75 and 1.89. The concentration of DNA obtained from tissue rolls was comparatively higher
than slide specimens while purity was nearly similar for rolls and
slides for each of the methods used (Table 1).
DNA isolated using the EZ1 and QIAamp Tissue Kit protocols
performed best in the real-time PCR. The GAPDH target could be
amplified successfully and specifically from the isolated DNA samples from all three DNA isolation protocols. The samples normalized
to the same concentration from different methods showed comparable CT values with slightly higher average CT values obtained with
the Gentra Puregene DNA. The average CT values for the amplification of the GAPDH gene from 10 ng/␮l genomic DNA were 31.5, 29.6
and 29.3 for Gentra Puregene, EZ1 and QIAamp methods, respectively (Table 1).
Discussion
Currently, FFPE tissues are increasingly used for molecular analyses both in clinical and research laboratories. The removal of
the paraffin wax encasing the thin layer of tissue and isolation of
sufficient intact DNA are major obstacles to working with these
samples. In recent years, the methods and protocols for the isolation of nucleic acids from FFPE tissues have improved enormously
[8–10]. For use in routine molecular diagnostics, a successful isolation protocol should be effective, reproducible, less labor-intensive
and time-consuming. Here, we describe an efficient protocol for the
isolation of genomic DNA from FFPE tissue samples.
Based on our observations, the Gentra Puregene Tissue Kit produced highest yield, however, hands-on-time required to isolate
the DNA was significantly higher than the other two methods. The
real-time PCR performed using the GAPDH gene served as a quality control measure of our DNA purification methods. Generally,
S.S. Sam et al. / Pathology – Research and Practice 208 (2012) 705–707
707
Table 1
Comparison of parameters analyzed for the Qiagen DNA isolation methods.
Sample A
ng/l
Gentra
EZ1
QIAamp
A260 /A280
Gentra
EZ1
QIAamp
CT a
Gentra
EZ1
QIAamp
a
Sample B
Sample C
Sample D
Sample E
Roll
Slide
Roll
Slide
Roll
Slide
Roll
Slide
Roll
Slide
127
38
29
64.4
27
21
151
102
38
73
54
29
131
86
46
83
65
26
208
80
65
146
62
46
73.7
58
62
66
37
44
1.70
1.73
1.68
33.6
30.3
29.9
1.78
1.78
1.88
35.2
31.7
29.4
1.91
1.77
1.98
32.8
31.0
31.3
1.73
1.81
1.90
29.8
31.4
29.3
1.69
1.78
1.93
28.6
27.8
28.1
1.82
1.82
1.92
29.9
27.4
27.0
1.88
1.85
2.00
30.3
28.8
28.8
1.55
1.82
1.86
30.7
28.3
28.6
1.80
1.83
1.84
31.2
29.1
29.7
1.68
1.78
1.88
32.8
30.5
30.6
All samples were normalized to 10 ng/␮l concentration for real-time PCR.
the samples that are too degraded for analysis of housekeeping
genes are unsuitable for downstream applications that amplify
DNA sequences of similar length [3]. The GAPDH target could be
amplified from all isolated DNA samples with lower CT values from
EZ1 and QIAamp isolated samples compared to the Gentra protocol. This could indicate a decrease in DNA quality or an increased
presence of PCR inhibitors in the DNA obtained with the Gentra
protocol.
The EZ1 method surpassed the other DNA isolation methods
with reduced hands-on-time to produce optimum concentration
of high quality DNA for use in routine molecular analyses. Methods that yield high quality DNA with optimum concentration and
relatively less hands-on-time for isolation are important factors to
consider while processing the DNA samples for downstream applications. The EZ1 method meets those requirements to be used for
routine molecular analyses. The method utilizes magnetic-particle
technology and therefore produces high-quality DNA suitable for
direct use in various molecular applications such as amplification
or other enzymatic reactions.
The deparaffinization buffer used in the EZ1 protocol remains
in the sample tube while Proteinase K digestion is carried out.
Thus, the sample loss during the deparaffinization is avoided as
sample pelleting and removal of paraffin containing supernatant
is not required for this protocol. Initial heating followed by cooling results in sticking of paraffin to the tube walls, and this allows
for efficient digestion of the tissues [11]. The main difference in
the amount of isolated DNA between the EZ1 and spin column
protocols can be attributed to sample loss in silica columns during several processing steps. However, the average A260 /A280 ratios
obtained from both the protocols were between 1.8 and 1.89. The
results from the real-time PCR demonstrate that the EZ1 method
can be potentially used for isolating DNA for downstream molecular
applications. Recently, DNA isolated from FFPE tissue using the EZ1
DNA tissue method has been used to investigate high throughput
sequencing technologies in cancer genomics, which further supports our observations that the method could be successfully used
for downstream applications, allowing for an integrative analysis
of tissue samples [12].
In summary, the EZ1 protocol requires less hands-on-time to
yield optimum DNA concentration and quality and is found to be
an efficient method for purifying DNA from FFPE tissues. This is
a significant factor when the isolation of DNA has to be routinely
employed in clinical laboratories for various genetic analyses as
molecular techniques are moving rapidly from research to routine
use in diagnostic pathology.
References
[1] N. Blow, Tissue preparation: tissue issues, Nature 448 (2007) 959–963.
[2] U. Lehmann, H. Kreipe, Real-time PCR analysis of DNA and RNA extracted
from formalin-fixed and paraffin-embedded biopsies, Methods 25 (2001)
409–418.
[3] V.J. Gnanapragasam, Unlocking the molecular archive: the emerging use of
formalin-fixed paraffin-embedded tissue for biomarker research in urological
cancer, BJU Int. 105 (2010) 274–278.
[4] N. Ludyga, B. Grünwald, O. Azimzadeh, S. Englert, H. Höfler, S. Tapio, M. Aubele,
Nucleic acids from long-term preserved FFPE tissues are suitable for downstream analyses, Virchows Arch. 460 (2012) 131–140.
[5] M.T. Gilbert, T. Haselkorn, M. Bunce, J.J. Sanchez, S.B. Lucas, L.D. Jewell, E.
Van Marck, M. Worobey, The isolation of nucleic acids from fixed, paraffinembedded tissues-which methods are useful when? PLoS One 2 (2007)
e537.
[6] G. Turashvili, W. Yang, S. McKinney, S. Kalloger, N. Gale, Y. Ng, K. Chow, L.
Bell, J. Lorette, M. Carrier, M. Luk, S. Aparicio, D. Huntsman, S. Yip, Nucleic acid
quantity and quality from paraffin blocks: defining optimal fixation, processing
and DNA/RNA extraction techniques, Exp. Mol. Pathol. 92 (2012) 33–43.
[7] W.Y. Huang, T.M. Sheehy, L.E. Moore, A.W. Hsing, M.P. Purdue, Simultaneous
recovery of DNA and RNA from formalin-fixed paraffin-embedded tissue and
application in epidemiologic studies, Cancer Epidemiol. Biomarkers Prev. 19
(2010) 973–977.
[8] J.F. Regan, M.R. Furtado, M.G. Brevnov, J.A. Jordan, A sample extraction method
for faster, more sensitive PCR-based detection of pathogens in blood culture, J.
Mol. Diagn. 14 (2012) 120–129.
[9] J.B. Okello, J. Zurek, A.M. Devault, M. Kuch, A.L. Okwi, N.K. Sewankambo, G.S.
Bimenya, D. Poinar, H.N. Poinar, Comparison of methods in the recovery of
nucleic acids from archival formalin-fixed paraffin-embedded autopsy tissues,
Anal. Biochem. 400 (2010) 110–117.
[10] C.J. Huijsmans, J. Damen, J.C. van der Linden, P.H. Savelkoul, M.H. Hermans,
Comparative analysis of four methods to extract DNA from paraffin-embedded
tissues: effect on downstream molecular applications, BMC Res. Notes 3 (2010)
239.
[11] Unlocking your FFPE archive: critical factors for molecular analysis of FFPE samples Qiagen FFPE Brochure, 2010. Available at:
http://www.qiagen.com/literature/render.aspx?id=200780
[12] M. Kerick, M. Isau, B. Timmermann, H. Sültmann, R. Herwig, S. Krobitsch, G.
Schaefer, I. Verdorfer, G. Bartsch, H. Klocker, H. Lehrach, M.R. Schweiger, Targeted high throughput sequencing in clinical cancer settings: formaldehyde
fixed-paraffin embedded (FFPE) tumor tissues, input amount and tumor heterogeneity, BMC Med. Genom. 4 (2011) 68.