Download Induction of the white egg3 mutant phenotype by injection of the

Insect Molecular Biology (2002) 11(3), 217–222
Induction of the white egg 3 mutant phenotype
by injection of the double-stranded RNA of
the silkworm white gene
Blackwell Science, Ltd
G. X. Quan, T. Kanda and T. Tamura
Insect Biotechnology and Sericology Department, National
Institute of Agrobiological Sciences, Ibaraki, Japan
Abstract
Injection of double-stranded RNA (dsRNA) corresponding to the silkworm white gene (Bmwh3) into
preblastoderm eggs of the wild-type silkworm induced
phenotypes similar to those observed with mutants of
the white egg 3 locus (10 – 19.6). The induced phenotypes were characterized by the presence of white
eggs and translucent larval skin. Northern analysis
showed that the expression of the endogenous Bmwh3
gene in the injected embryos was distinctly depressed.
Furthermore, the injection of the GFP dsRNA inhibited
the expression of the GFP gene from a plasmid coinjected with the dsRNA but did not depress the
expression of the Bmwh3 gene. These findings
demonstrate that sequence-specific RNA interference
occurred in the silkworm. We conclude from the results
that the RNA interference can be applied as a tool for
the analysis of the gene function in the lepidopteran
insects.
Keywords: Bombyx mori, w3 mutant, white gene, RNAi.
Introduction
Gene silencing caused by double-stranded RNA (dsRNA),
referred to as RNA interference (RNAi), has provided a
powerful tool for studying gene function in animals and
plants. RNAi was first observed in Caenorhabditis elegans
by Fire et al. (1998) who showed that the introduction of
dsRNA into the cells inhibited the expression of the corresponding gene. Subsequently, it was found that RNAi
occurred in many organisms from fungi to animals and that
the method could be applied selectively to knockout gene
Received 20 August 2001; accepted after revision 2 January 2002. Correspondence: Toshiki Tamura, Insect Biotechnology and Sericology Department, National Institute of Agrobiological Sciences, Owashi 1 – 2, Tsukuba,
Ibaraki 305 – 8634, Japan. Tel.: 81 298386091; Fax: 81 298386028; e-mail:
[email protected]
© 2002 Royal Entomological Society
function. (Sharp, 1999; Misquitta & Paterson, 1999;
Catalanotto et al., 2000; Hammond et al., 2000). Selective
gene silencing has proven to be highly efficient except in
a few cases in zebrafish where silencing was not always
sequence-specific (Li et al., 2000; Oates et al., 2000; Zhao
et al., 2001).
The mechanism of gene silencing by dsRNA results from
cleavage of the dsRNA into fragments of about 22 nucleotides within the cells (Zamore et al., 2000; Elbashir et al.,
2001). These nucleotide fragments serve as guide sequences
that assemble a silencing complex to destroy specific messenger RNAs (Zamore et al., 2000; Bernstein et al., 2001;
Hammond et al., 2001).
RNAi has been utilized with some success to assess
activity of specific genes in Drosophila (Kennerdell &
Carthew, 1998; Bhat et al., 1999; Misquitta & Paterson, 1999;
Willert et al., 1999; Yu et al., 1999; Huang et al., 2000).
These investigations resulted in silencing of embryonic
genes after injecting dsRNA into syncytial blastoderm-stage
embryos. RNAi has been used successfully in silencing
embryonic genes in the red flour beetle, Tribolium castaneum (Brown et al., 1999). It was also effective in
silencing larval haemocyte genes in the flesh fly Sarcophaga
(Nishikawa & Natori, 2001). However, efforts to silence
late-acting genes using dsRNA injected into early embryos
have met with little success due to dilution from progressive
cell divisions. RNAi for the Drosophila white eye gene
resulted in recovery of less than 3% of knockouts in adults
(Misquitta & Paterson, 1999).
For most non-dipteran insects, RNAi has not been
assessed as a tool for the silencing of specific genes. To
investigate whether the method can be applied to lepidopteran insects, we examined the effect of dsRNA on the silkworm Bombyx mori white gene (Bmwh3 ). The Bmwh3 gene
has been reported to be homologous to the Drosophila
white gene (Abraham et al., 2000). The Drosophila WHITE
is involved in the transport of the precursors of the ommochrome and pteridine pigments (Sullivan et al., 1980; Ewart
et al., 1994; Mackenzie et al., 1999) in the eye where they
combine to produce the distinctive eye colour. Mutants of the
white gene lose the ability to transport the precursors and
fail to accumulate the pigments in the eye (Mackenzie et al.,
1999), resulting in the white eye phenotype in Drosophila.
217
218
G. X. Quan, T. Kanda and T. Tamura
The Bmwh3 gene is a suitable gene to determine the
effect of the dsRNA-mediated interference in the silkworm.
In the wild-type silkworm, the eggs and the eyes are dark
brown. This colour is caused by the accumulation of ommochrome pigments. Although several different loci responsible for the white egg mutations have been identified, the
silkworm white (Bmwh3 ) gene is related to mutations of the
white egg 3 (w3 ) locus (10 – 19.6) (Abraham et al., 2000).
The w3 locus is multiallelic, and several mutations, such as
the white egg 3 (w3), the white-egg translucent (w3 oe ) and
Aojuku white-egg translucent (w3 ol ) have been mapped to
this locus. Currently RNAi is most effective on genes
expressed during the embryonic and early larval stages,
and the presence of a few dsRNA molecules per cell is
sufficient to silence gene expression (Fire et al., 1998;
Kennerdell & Carthew, 1998). This fact indicates that genes
related to egg colour mutants would be the most suitable
genes to determine whether the RNAi acts in the silkworm
because these genes are expressed at the early stage of the
embryonic development and the morphological changes
can be easily observed. In addition, the function of the
Bmwh3 gene is cell-autonomous, and the protein controls
the transport of the precursor of the ommochrome pigment.
It is expected that the silencing of this gene should directly
induce morphological changes. Therefore, the Bmwh3
gene appears to be a good candidate to test gene silencing
by RNAi in the silkworm.
In this work, we assessed the effect of injection of
Bmwh3 dsRNA into preblastoderm embryos of B. mori to
establish the utility of RNAi in Lepidoptera. Injection of
dsRNA corresponding to Bmwh3 gene induced phenotypic
white eggs and translucent skinned larvae. The amount of
Bmwh3 transcript was concomitantly reduced. Furthermore, injection of dsRNA corresponding to the GFP gene
did not induce the white egg and translucent larval phenotype, suggesting that inhibition of the gene by the dsRNA
was sequence specific.
Results
Effects of the injection of the Bmwh3 dsRNA on the egg and
larval phenotype
To determine the effect of dsRNA on the silkworm white
gene (Bmwh3) (Fig. 1A), we injected dsRNA corresponding to Bmwh3 into the wild-type preblastoderm embryos.
Eggs of the wild-type silkworm are generally white just after
oviposition and the egg colour turns dark brown as embryonic development progresses (Fig. 2A). Immediately after
hatching, the cuticle of the larvae is dark brown. The cuticle
changes to white and opaque within 2 days after hatching.
The phenotypes of the mutations of the w3 locus were
slightly different in each mutant strain. For example, the
eggs of the w3 mutant were light brown (Fig. 2A) and the
larval skin was semi-translucent (Fig. 2A). In the w3 ol and
the w3 oe mutants, the eggs were white and the larval skin
was highly translucent (Fig. 2A). Other mutants for the w3
allele exhibited similar morphological characters. Therefore, the mutants belonging to this group were generally
characterized by the presence of white eggs and of larvae
with translucent skin. If these characters are related to the
gene function of the Bmwh3 as suggested by Abraham et al.
(2000), the depression of the Bmwh3 gene should result in
Figure 1. Features and sources of dsRNA used in the experiment. (A) Representation of the structure of the silkworm Bmwh3 cDNA. The 925 bp dsRNA of the
Bmwh3 gene is denoted by double lines. The probe used for the Northern analysis is indicated by the striped box. (B) Structure of the plasmid pPIGA3GFP. The
706 bp dsRNA of the GFP gene is denoted by double lines.
© 2002 Royal Entomological Society, Insect Molecular Biology, 11, 217– 222
Induction of w3 phenotype by dsRNA
219
Figure 2. Phenotypic changes following injection of the Bmwh3 dsRNA into the wild-type eggs. The black and white bars in the photo indicate 2 mm and 0.2 mm,
respectively. (A) Eggs and larvae of the wild-type strain 200 and the mutants w3, w3 ol and w3 oe. (B) Induction of the white eggs and translucent larvae by the
injection of the Bmwh3 dsRNA. The injection of the Bmwh3 or GFP dsRNA was performed in the eggs of the wild-type silkworm 200 at the preblastoderm stage.
The egg colour was observed at 4 days after oviposition and the larvae were observed on the third day of the first instar. (C) Expression of the GFP gene injected
into the eggs. The plasmid pPIGA3GFP (0.20 µg /µl) alone or with either the GFP (10 nM) or Bmwh3 (10 nM) dsRNAs was injected into the eggs. The expression
of the GFP gene was observed on the 4th day after oviposition.
© 2002 Royal Entomological Society, Insect Molecular Biology, 11, 217– 222
220
G. X. Quan, T. Kanda and T. Tamura
Table 1. Effect of the dsRNA injected into the eggs on the phenotypic changes
Injection
Concentration
of DsRNA*
(nM)
Number of
injected eggs
Number of
developed
eggs
Number of eggs with the
following colour (%)
Dark brown
Mosaic
White
Number of
eggs with GFP
expression(%)
Number of
hatched
larva (%)
Number of
translucent
larvae (%)
DsRNA
of GFP
0.1
1
10
100
51
50
50
51
46
45
46
48
46(100)
41(91)
46(100)
48(100)
0(0)
4(9)
0(0)
0(0)
0(0)
0(0)
0(0)
0(0)
n
n
n
n
7(15)
9(20)
14(30)
10(21)
0(0)
0(0)
0(0)
0(0)
DsRNA
of Bmwh3
0.1
1
10
100
96
99
104
102
92
99
95
100
86(94)
69(70)
12(13)
1(1)
4(4)
29(29)
51(54)
16(16)
2(2)
1(1)
32(34)
83(83)
n
n
n
n
26(28)
19(19)
14(15)
25(25)
0(0)
0(0)
0(0)
5(20)
0
10
10
50
51
50
50
47
48
46(92)
41(87)
0(0)
3(6)
6(13)
5(10)
1(2)
0(0)
43(90)
P
P + GFP
P + Bmwh3
45(90)
0(0)
36(75)
n
n
n
n
n
n
*Injection of 2 – 3 nL of 0.1 – 100 nM solution of the dsRNA, corresponding to roughly 105−108 molecules; P, GFP plasmid DNA (0.20 µg/µL); P + GFP, GFP
plasmid DNA (0.2 µg/µL) and 10 nM dsRNA of GFP gene; P + Bmwh3, GFP plasmid DNA (0.2 µg /µL) and 10 nM dsRNA of Bmwh3; n, not examined.
the induction of white egg and of larvae with translucent
skin.
Injection of dsRNA for Bmwh3 induced white eggs as
well as brown and white mosaic eggs as expected
(Fig. 2B). On the other hand, eggs injected with GFP
dsRNA as the non-specific control were dark brown
(Fig. 2B). The frequency of the appearance of the white and
mosaic eggs varied depending on the amount of Bmwh3
dsRNA injected. The greater the concentration of the dsRNA
solution injected, the higher the frequency of appearance of
white and mosaic eggs (Table 1). When a 100 nM solution
of Bmwh3 dsRNA was injected, most of the eggs became
white. It was only at the 100 nM concentration of Bmwh3 dsRNA
that larvae exhibited a phenotype with a translucent skin
(Fig. 2B, Table 1). Although the frequency of larvae exhibiting translucent skin was not high, those larvae with the
phenotype maintained the condition until the second
instar.
Injection of the GFP dsRNA inhibits only the expression of
the GFP gene
Figure 3. Northern blot hybridization of the RNAs extracted from the eggs
injected with the dsRNA of the Bmwh3 gene. The Bmwh3 dsRNA (100 nM)
or the GFP dsRNA (100 nM) were injected into the eggs and the RNAs were
collected from the eggs at 4 days after oviposition. The eggs without
injection corresponded to the control. Eight micrograms of the purified
+
poly(A) RNAs were used in each lane and hybridized with the probe of the
Bmwh3 gene (Fig. 1A) or with that of the silkworm elongation factor 1-α.
To determine whether the dsRNA silencing was sequence
specific, we examined the effect of dsRNA on the expression of the Bmwh3 and GFP genes in embryos. Microinjection of the plasmid pPIGA3GFP into preblastoderm embryos
results in transient expression of the GFP gene in 90% of
the eggs (Table 1, Fig. 2C). On the other hand, co-injection
of the pPIGA3GFP plasmid with GFP dsRNA eliminated
GFP expression in all of the eggs injected and the eggs had
wild-type brown colouration. Co-injection of the pPIGA3GFP
plasmid with Bmwh3 dsRNA resulted in more than 70% of
the eggs showing GFP expression. In addition, many eggs
exhibited the white or mosaic phenotype indicating that the
dsRNA of the Bmwh3 gene silenced only the expression of
the Bmwh3 gene. These results indicate that interference of
© 2002 Royal Entomological Society, Insect Molecular Biology, 11, 217– 222
Induction of w3 phenotype by dsRNA
the dsRNAs in the silkworm occurred in a sequencespecific manner.
DsRNA depresses levels of the corresponding mRNA
A Northern analysis was performed to assess the effect of
dsRNA silencing on the levels of specific RNAs in the
injected eggs. Poly(A)+ RNA was isolated from each group
of eggs and equal amounts of poly(A)+ RNA were electrophoresed for each preparation. Uninjected eggs and eggs
injected with GFP dsRNA contained significant amounts
of endogenous Bmwh3 mRNA (Fig. 3). However, eggs
injected with Bmwh3 dsRNA contained a much smaller
amount of mRNA when compared with the control eggs.
Equal loading of the samples was confirmed by hybridization with a probe for the silkworm EF1-α. This finding
suggests that the white egg and translucent skin larvae
phenotypes observed after injection of Bmwh3 dsRNA was
due to a reduction in the amount of Bmwh3 mRNA and
consequently a reduction in the accumulation of pigments.
Discussion
We have shown that injection of Bmwh3 dsRNA into preblastoderm eggs caused silencing of the Bmwh3 locus and
induction of the white eggs and translucent larvae phenotypes similar to that observed in white egg 3 (w3) mutations. The action of the Bmwh3 dsRNA resulted in a
reduction in the level of Bmwh3 mRNA accumulating in the
eggs. This effect was sequence specific because injection
of GFP dsRNA did not reduce endogenous Bmwh3 mRNA.
Sequence-specific silencing was also shown for GFP
expression by interfering with the transient expression of
GFP from a plasmid without affecting the colour of the eggs
and larvae. This is the first report in which it is shown that
RNAi acts in the silkworm.
We conclude from these results that the mechanism of
sequence-specific degradation by dsRNA exists in the silkworm and that the injection of dsRNA into eggs can be
used to analyse gene function in the silkworm, especially
for the genes expressed at the early embryonic stage.
Application of this technique to gene function analysis is
critical to the examination of more than 24000 ESTs of the
silkworm genes which are available as a data base (SilkBase, http://www.ab.a.u-tokyo.ac.jp/silkbase/). We expect
that the method established in these experiments will be
applied to further analyse the gene function of the silkworm
and contribute to the progress of post-genome studies in
lepidopteran insects.
221
colour of the strain 200 is dark brown and the larval skin is white
and opaque. The mutant strains for the white egg 3 allele, e01
ol
white egg 3 (w3 ), e02 Aojuku white-egg translucent (w3 ) and e03
oe
white-egg translucent (w3 ) were obtained from the Institute of
Genetic Resources, Kyushu University, Kyushu, Japan. The larvae
were reared on an artificial diet (Nihon Nosan) at 25 °C. To break
the embryonic diapause, eggs within 4 h after oviposition were
treated with 0.9 N HCl for 1 h at 25 °C. The eggs were kept until 6 –
7 h after oviposition and were then used for the microinjection of
dsRNA by the method of Kanda & Tamura, 1991. Two to three nl
of the solution were injected into each egg. The injected eggs were
incubated at 25 °C in a moist Petri dish. Eggs that were viable after
four days of embryonic development were observed for the expression
of GFP using a fluorescence microscope with the GFP2 filter (Leica).
Construction of the dsRNAs
To produce the dsRNAs for Bmwh3 and GFP, PCR fragments for
each were cloned into pGEM-T plasmid (Promega). A 925 bp DNA
fragment of the silkworm white gene (Bmwh3, Abraham et al.,
2000), was amplified using Bmwh3 cDNA as template with the
primers CTACGGAGCCATCGGAGGTATT and GGCCGTGCAAACTGTATCTATG. A 706 bp DNA fragment of the green fluorescent
protein (GFP) gene was PCR amplified using the plasmid
pPIGA3GFP (Tamura et al., 2000) as the template with the primers
TGGTGAGCAAGGGCGAGGAG and TCGTCCATGCCGAGAGTGAT. Plasmids with PCR fragments inserted in both directions for
the Bmwh3 and GFP genes were isolated for the synthesis of the
dsRNAs. The sense and antisense RNAs were synthesized for
each gene target using the RiboMAX Large Scale RNA Production
Systems-T7 (Promega). The plasmids were linearized by the
digestion with the restriction enzyme PstI and used as the
template for the RNA synthesis. Following the RNA synthesis, the
reaction mix was extracted with phenol / chloroform, precipitated
with ethanol and dissolved in RNase-free water. Equal molar
amounts of the sense and antisense RNAs were mixed in the
10 mM Tris-HCl (pH 7. 5) / 20 mM NaCl buffer, and heated at 95 °C
for 1 min. To anneal the dsRNA, the heated RNA solution was kept
at 25 °C for 12–16 h. The annealed dsRNA was treated with
RNaseA (1 µg/ml) at 37 °C for 30 min, extracted with phenol/
chloroform, precipitated with ethanol and dissolved in distilled
water. The formation of the dsRNA was confirmed by non-denaturing
agarose gel electrophoresis. The injection solutions were prepared
by dilution of the dsRNAs in distilled water.
Northern blot hybridization
Total RNA was purified by ISOGEN (Nippongene) from developing
eggs four days after oviposition for Northern blot hybridization.
Poly(A)+ RNA was isolated with Oligotex-dT30 <Super> (Roche
Molecular Biochemicals). The poly(A)+ RNAs were separated on a
1% agarose gel by the method of Goda & Minton (1995) and transferred to a Hybond-N membrane (Amersham Pharmacia Biotech).
Hybridization and detection were performed with the AlkPhos
Direct Labeling and Detection System (Amersham Pharmacia
Biotech).
Experimental procedures
Silkworm strains and microinjection
The bivoltine silkworm strain 200 was obtained from the Gunma
Sericultural Experiment Station and used as a wild-type. The egg-
Acknowledgements
We thank Dr N. Kômoto (Genetics and Evolution Department, National Institute of Agrobiological Sciences) for
© 2002 Royal Entomological Society, Insect Molecular Biology, 11, 217– 222
222
G. X. Quan, T. Kanda and T. Tamura
useful discussions and Dr P. Shirk (USDA-ARS) for critical
reading of the manuscript. This work was partly supported
by MAFF and Program for the Promotion of Basic Research
Activities for Innovative Bioscience, Japan.
References
Abraham, E.G., Sezutsu, H., Kanda, T., Sugasaki, T., Shimada, T.
and Tamura, T. (2000) Identification and characterization of a
silkworm ABC transporter gene homologous to Drosophila
white. Mol General Genet 264: 11–19.
Bernstein, E., Caudy, A.A., Hammond, S.M. and Hannon, G.J.
(2001) Role for a bidentate ribonuclease in the initiation step of
RNA interference. Nature 409: 363–366.
Bhat, M.A., Izaddoost, S., Lu, Y., Cho, K.O., Choi, K.W. and
Bellen, H.J. (1999) Discs Lost, a novel multi-PDZ domain
protein, establishes and maintains epithelial polarity. Cell 96:
833–845.
Brown, S.J., Mahaffey, J.P., Lorenzen, M.D., Denell, R.E. and
Mahaffey, J.W. (1999) Using RNAi to investigate orthologous
homeotic gene function during development of distantly related
insects. Evol Dev 1: 11–15.
Catalanotto, C., Azzalin, G., Macino, G. and Cogoni, C. (2000)
Gene silencing in worms and fungi. Nature 404: 245.
Elbashir, S.M., Harborth, J., Lendeckel, W., Yalcin, A., Weber, K.
and Tuschl, T. (2001) Duplexes of 21-nucleotide RNAs mediate
RNA interference in cultured mammalian cells. Nature 411:
494–498.
Ewart, G.D., Cannell, D., Cox, G.B. and Howells, A.J. (1994)
Mutational analysis of the traffic ATPase (ABC) transporters
involved in uptake of eye pigment precursors in Drosophila
melanogaster. Implications for structure-function relationships.
J Biol Chem 269: 10370–10377.
Fire, A., Xu, S.Q., Montgomery, M.K., Kostas, S.A., Driver, S.E.
and Mello. C.C. (1998) Potent and specific genetic interference
by double-stranded RNA in Caenorhabditis elegans. Nature
391: 806–811.
Goda, S.K. and Minton, N.P. (1995) A simple procedure for gel
electrophoresis and Northern blotting of RNA. Nucleic Acids
Res 23: 3357–3358.
Hammond, S.M., Bernstein, E., Beach, D. and Hannon, G.J. (2000)
An RNA-directed nuclease mediates post-transcriptional gene
silencing in Drosophila cells. Nature 404: 293–296.
Hammond, S.M., Caudy, A.A. and Hannon, G.J. (2001) Posttranscriptional gene silencing by double-stranded RNA. Nature
Rev Genet 2: 110–119.
Huang, M.L., Hsu, C.H. and Chien, C.T. (2000) The proneural
gene amos promotes multiple dendritic neuron formation in the
Drosophila peripheral nervous system. Neuron 25: 57– 67.
Kanda, T. and Tamura, T. (1991) Microinjection system into the
early embryo of the silkworm, Bombyx mori, by using air pressure. Bull Seric Entomol 2: 32 – 46. (In Japanese with English
summary).
Kennerdell, J.R. and Carthew, R.W. (1998) Use of dsRNAmediated genetic interference to demonstrate that frizzled and
frizzled 2 act in the wingless pathway. Cell 95: 1017 – 1026.
Li, Y.X., Farrell, M.J., Liu, R., Mohanty, N. and Kirby, M.L. (2000)
Double-stranded RNA injection produces null phenotypes in
zebrafish. Dev Biol 217: 394 – 405.
Mackenzie, S.M., Brooker, M.R., Gill, T.R., Cox, G.B., Howells, A.J.
and Ewart, G.D. (1999) Mutations in the white gene of Drosophila melanogaster affecting ABC transporters that determine eye colouration. Biochim Biophys Acta 1419: 173 –185.
Misquitta, L. and Paterson, B.M. (1999) Targeted disruption of
gene function in Drosophila by RNA interference (RNAi): a role
for nautilus in embryonic somatic muscle formation. Proc Natl
Acad Sci USA 96: 1451 – 1456.
Nishikawa, T. and Natori, S. (2001) Targeted disruption of a pupal
hemocyte protein of Sarcophaga by RNA interference. Eur J
Biochem 268: 5295 – 5299.
Oates, A.C., Bruce, A.E. and Ho, R.K. (2000) Too much interference: injection of double-stranded RNA has nonspecific effects
in the zebrafish embryo. Dev Biol 224: 20 – 28.
Sharp, P.A. (1999) RNAi and double-strand RNA. Genes Dev 13:
139 – 141.
Sullivan, D.T., Bell, L.A., Paton, D.R. and Sullivan, M.C. (1980)
Genetic and functional analysis of tryptophan transport in
Malpighian tubules of Drosophila. Biochem Genet 18: 1109 –
1130.
Tamura, T., Thibert, C., Royer, C., Kanda, T., Abraham, E.,
Kamba, M.K., Kômoto, N., Thomas, J.-L., Mauchamp, B.,
Chavancy, G., Shirk, P., Fraser, M., Prudhomme, J.-C. and
Couble, P. (2000) A piggyBac-derived vector efficiently promotes
germ-line transformation in the silkworm Bombyx mori L. Nature
Biotechnol 18: 81 – 84.
Willert, K., Logan, C.Y., Arora, A., Fish, M. and Nusse, R. (1999)
A Drosophila Axin homolog, Daxin, inhibits Wnt signaling.
Development 126: 4165 – 4173.
Yu, X., Waltzer, L. and Bienz, M. (1999) A new Drosophila APC
homologue associated with adhesive zones of epithelial cells.
Nat Cell Biol 1: 144 – 151.
Zamore, P.D., Tuschl, T., Sharp, P.A. and Bartel, D.P. (2000)
RNAi: double-stranded RNA directs the ATP-dependent
cleavage of mRNA at 21 – 23 nucleotide intervals. Cell 101: 25 –
33.
Zhao, Z., Cao, Y., Li, M. and Meng, A. (2001) Double-stranded
RNA injection produces nonspecific defects in zebrafish. Dev
Biol 229: 215 – 223.
© 2002 Royal Entomological Society, Insect Molecular Biology, 11, 217– 222