Download Interaction of a Nuclear Protein with 5` Flanking Region of

Mol. Cells, Vol. 1, pp. 145-149
Interaction of a Nuclear Protein with 5' Flanking Region of
Gamma-Zein Gene from Maize
Jae-Seong So*, Kalyanram B. Geetha and Brian A. Larkins
Department of Plant Sciences, University of Arizona, Tucson, Arizona 85721, U S. A.
(Received on February 8, 199 1)
We investigated protein-DNA interactions between the 5' flanking region of a gamma-zein
gene and nuclear proteins isolated from developing maize endosperm. Two distinct DNA
regions showed DNNprotein complex formation based on gel retardation assays. Competition experiments suggested that the two sequences interacted with the same protein but
with different affinities. Gel retardation assays with various DNA fragments and chemical
footprinting analyses delimited the minimum DNA sequences responsible for complex
formation at nucleotides - 839 to - 810 for the distal sequence and - 327 to - 235 for
the proximal sequence relative to the start of transcription. These two regions share the
sequence TTAAAACAAAA, which may serve as the primary recognition sequence. This
sequence was protected from digestion in chemical footprinting analyses. From sequence
analysis of 5' flanking 1-kb region of gamma-zein genes from a wild type W64A +, an
opaque-2 and a modified opaque-2, the modified opaque-2 mutant which has high levels
of gamma-zein contains an extra 16-bp AT-rich sequence at 3' of the footprinted sequence.
The presence of this additional AT-rich sequence appears to increase the affinity of binding
of the nuclear protein.
The prolamine storage proteins of maize fall into
four classes: alpha zein (sulphur-poor), and beta-, gamma-, and delta-zein (all sulphur-rich). The expression of genes encoding the four zein classes is coordinately regulated during endosperm development (Larkins et af., 1989). The opaque-2 mutation causes a significant reduction in the transcription of genes encoding alpha-zein, but has little effect on the transcription of gamma-zein genes (Kodrzycki et al., 1989). In
"modified" opaque-2 genotypes (the QPM lines), gamma-zein proteins are present at the concentrations
two to four times as high as in "unmodified" opaque2 lines (Wallace et al., 1990). It is not known whether
the "modifier" genes in the QPM lines act in a cis
or trans manner. The gamma-zein gene promoters
from a wild type maize inbred (W64A +), a standard
opaque-2 line (W64A02), and a "modified" opaque-2
genotype (QPM Blanco Dentado) are identical for the
first thousand nucleotide upstream of the transcription
start site except for an extra AT-rich sequence inserted
between nucleotide -847 and -681 in the "modified"
opaque-2 mutant. We have found that a nuclear protein binds to this DNA sequence and this nuclear
protein binds more strongly to the AT-rich insertion
in the gene from the modified opaque-2 mutant than
to the gene from the unmodified mutant.
* To whom correspondence should be addressed at the present address: Department of Microbiology, University of British Columbia, Vancouver, BC V6T lW5, Canada
Materials and Methods
Materials
Restriction enzymes and DNA modifying enzymes
were purchased from Bethesda Research Laboratories,
Inc. (Gaithersburg, MD). Chemicals were obtained
from Sigma (St. Louis, MO), unless otherwise specified. Radioactive nucleotides were obtained from New
England Nuclear (Wilmington, DE).
Nuclear extracts
Nuclei were prepared from developing com endosperm essentially as previously described by Kodrzycki
et al. (1989). The crude nuclear pellet was resuspended
in nuclei resuspension buffer (50 mM Tris-HCI, pH
8.5, 5 mM MgCh, 10 mM 2-mercaptoethanol, and 50%
glycerol), and the nuclei were lysed by addition of
NaCI and spermidine at final concentrations of 0.5
M and 5 mM, respectively. After lysis (45 min on
ice), the solution was cleared by centrifugation at
12,000 X g for 30 min at 4 °C, and the supernatant
was dialysed at 4 "c for 4 h against two changes of
500 ml of dialysis buffer (10 mM Hepes [N-2-Hydroxyethylpiperazine-N'-2-ethanesulfonic acid], pH 8.0, I
mM MgCh, 50% glycerol, 50 mM NaCI, and 0.1 mM
PMSF [phenylmethylsulfonyl fluoride]). The dialysate
was centrifuged at 14,000 X g for 15 min to remove
insoluble material, and the aqueous supernatant was
stored at -80 °C. The protein concentration was determined using the method of Bradford (1976).
Preparation oj radioactive DNA fragments
© 1991 The Korean Society of Molecular Biology
146
Regulatory Region of Maize y-Zein Gene
The DNA fragments were labeled either by ruling
in the 3' recessed ends with [aY P]dATP, dCTP,
dGTP, TIP and Klenow fragment of DNA polymerase I or by kinase reaction of the 5' ends with [y32P]ATP and polynucleotide kinase after dephosphorylation with calf intestinal alkaline phosphatase (Maniatis et al., 1982). After 30-min incubation at room
temperature, the reaction mixture was extracted once
with phenol and the insert DNA was separated from
the vector DNA by preparative electrophoresis through
a \0% polyacrylamide gel. The labeled DNA was localized by autoradiography at room temperature for
1~2 min, excised from the gel, and eluted overnight
at 37 °C in 0.5 M NH4-acetate, 0.1% SDS, I mM EDTA
and \0 mM Mg-acetate. Unlabeled DNA fragments
were purified by similar procedures and used as competitors in protein/ DNA binding reactions.
Gel retardation assays
The binding reaction was carried out in a total volume of \0 ~ containing \0 mM Tris-HCI, pH 7.5,
50 mM NaCI, 1 mM EDTA, I mM OTT (dithiothreitol), 0.1 mM PMSF, 1 to 3 Ilg of nuclear protein, and
0.1 to 3.0 ng of the 32P-Iabeled DNA fragment (1-5,000
cpm). Synthetic poly (dI-dC) was used as a non-specific competitor DNA to reduce non-specific binding.
The assay mixture was incubated for 15 min at room
temperature prior to being loaded onto a 10% nondenaturing polyacrylamide gel (80:1, acrylamide:bisacrylamide) containing 6.7 mM Tris-HCI (PH 7.5), 3.3
mM acetic acid and 1 mM EDTA. The gel was prerun for 30 min at 15 V/cm. After loading the samples,
electrophoresis was run for 2 to 4 h at \0 V/cm. Gels
were dried and autoradiographed at room temperature.
Chemical jootprinting
Multiple protein/ DNA-binding reactions were carride out as described above. After th e protein/ DNA
complexes were separated from free DNA by electrophoresis, gels were soaked in 10 mM Tris-HCI (pH
7.5) for 5 min . The entire gel was subjected to the
copper/ortho-phenanthroline cleavage reaction (Kuwabara et aI., 1987). After cleavage of the DNA, the gels
were exposed to XAR-5 film for 4 to 16 h at room
temperature. The protein/ DNA complex and free
DNA were excised from the gel and eluted into a
high-salt buffer (0.5 mM NH 4-acetate, 0.1 % SDS, I mM
EDTA and \0 mM Mg-acetate). Following ethanol
precipitation and radioactivity measurement, samples
of free and bound DNA containing equal amounts
of radioactivity were separated on a 6% polyacrylamide 7 M urea sequencing gel and analyzed by autoradiography. The location of the protein binding region was determined by co-electrophoresis of a DNA
sequencing reaction.
Results and Discussion
Gene expression in eukaryotes is controlled by th e
specific interaction of DNA-binding proteins with cisacting DNA regulatory sequences (Mitchell and Tjian,
A
Mol. Cells
--100bp
5
I
5
I
5
5
I
I
,,5
I I
4
1
2
B
1:
2:
·235/-86
3:
·217/·133
-86/-10
4 :
-327/-217
5 :
-397/ -327
6:
-681 / -397
7:
·681 /·599
8 :
-1032/-681
+ ~ + - + - + - + - +- + _+
1
2
3
4
5
6
7
8
nuclearextrac1 fragmen1
Figure 1. Interaction of DNA fragments of ga mma-zein gene
with nuclear proteins from endosperm. (A) .Restriction map
of the promoter region of the gamma-zein gene of the maize
inbred W64A + . The fragments numbered I through 8 were
tested for binding with nuclear proteins from 12-DAP endospeml . Transcription start point is marked with an arrow.
CAAT and TATA elements are indicated. (5. Sau3Al ; A
A fuI ) (8) Autoradiogram of gel reta rdation assay. Fragments
I through 8 were radioactively labeled and incubated with
I Ilg of 12-DAP endosperm nuclear proteins in the presence
of I Ilg of poly(dI-dC). and the DNNprotein co mplexes were
resolved in a gel retardation assay as desclibed in Matelials
and Methods. The base pairs th at delimit fragments I through 8 are indicated on the left.
1989). Several DNA-binding proteins have been identified that may pl ay a role in seed storage protein
ge ne regulation (Maier el al., 1988, 1989; Allen el al.,
1989; Bustos el al., 1989». To cha racterize the molecula r mech an isms that mediate the regulation of zein
ge ne transcription we analyzed interaction s of DNAbinding proteins with th e 5/ flanking region of gamm a-zein genes of maize.
DNA fragments of the 5/ fl a nking region (Fig. lA)
of the gamma-zein gene from a wild type maize line
W64A + were subcloned into pG EM3Z (Promega,
Madison, W1). Each DNA fragment was radiol abeled
and reacted with nuclear proteins from 12-DAP (days
after pollination) developing maize endosperm, and
the protein/DNA complexes were a nalyzed by gel retardation assay (Fried and Croth er, 1981; Revz in. 19
89). This technique is based on the observation that
the movement of a DNA mol ecule through a non denaturing polyacryl amide gel is slowed down when a
protein molecule is bound to it. As shown in Figure
I B, two DNA fragments form ed a protein/ DNA complex with endosperm nuclear protein that was stable
in the presence of high co ncentration s of poly (dT-dC)
(fragments 4 and 8). The two fragments a re approximately 600 bp apart from each oth er. It is interesting
to note that under our experi mental conditions we
were unable to detect a ny stable protein/ DNA complexes with DNA fragment containing CAAT a nd
Jae-Seong So
Vol. I (1991)
Lane No. 1
Nuclear Extract -
-397
r
~
-10321-932
Lanes 1,2
Lanes 3,4
Lanes 5,6
Lanes 7,8
Lanes 9,10
al.
147
the individual fragment was reacted with endosperm
nuclear proteins. The binding region within the fragment 8 was determined to be between base pairs -847
and - 681, which was refelTed to fragment 8' hereafter
(Fig. 2, lanes 7 and 8).
To determine whether the two distinct fragments
4 and 8' share a common DNA-binding protein, competit~ve binding assays were carried out, where radiolabeled DNA fragment 4 was reacted with endosperm
nuclea r proteins in the presence of increasing amounts
of cold DNA fragments 4 and 8' as competitors_
DNN protein interaction was abolished by the addition of both cold DNA fragment 4 and fragment 8'
(Fig. 3). In contrast, the addition of non-radioactive
DNA fragment 2 (Fig. IA) did not affect the complex
formation. Assuming that the radioactivity associated
with the protein/ DNA complexes reflects affinity, the
fragment 8' appeared to have about 5-fold higher affinity for the factor. The addition of 25-fold molar excess of fragment 8' (Fig. 3, lane b2) competed as effectively as 125-fold molar excess of fragment 4 (Fig. 3,
lane a3). The protein/ DNA complex was abolished
by addition of proteinase K (1 mg/ml) in the reaction
mixture but not with RNase A (I mg/ml), indicating
its proteinaceous nature (data not shown). Interestingly
the protein factor was found to be extremely heat resista nt as boiling of nuclear proteins for 10 min did
not abolish the complex formation (data not shown).
Recently, a nuclear factor was identified in soybean
root nodules that interacted with soybean nodulin
gene promoters (Jacobsen et at.. 1990). The nodule nuclear factor was found to be an HMG-like protein
and to be extremely heat-resistant.
To more exactly localize the recognition sequence
2 3 4 5 6 7 8 9 10
+ - + - + - + - +
-1032
Probes
el
-10321-a.7
-9321-&1
-a.7/-&1
-10321-&1
Figure 2. Binding of a nuclear protein to a region (- 847
to - 681) of fragment 8. Fragment 8 (lanes 9 and 10) and
four smaller fragments (lanes 1 through 8) were radioactively
labeled and incubated with I /-lg of endosperm nuclear proteins in the presence of I /-lg of poly(dl-dC). The DNNprotein complexes were resolved in a gel retardation assay as
described in M ate rial s and Methods. (S. Sau3A1 ; R, RsaI;
N, NdeI ) The fragment from -847 to - 681 (la nes 7 and
8) is referred to as fragment 8' in subsequent Figures.
TATA elements which are believed to play crucial
roles in transcription by interacting with several transcription factors (fragment I, in Fig. IA). To more precisely localize the protein binding site within the fragment 8, four smaller fragments were subcloned and
Competition Experiments with Three Distinct Fragments
of Gamma-Zein Gene 5' Flanking Region
a
+1
2
c
b
3
4
1
2
3
4
1
2
3
4
Figure 3. Competitive gel reta rdatio n assay. One na nogra m of radioactively labeled fragment 4 ( - 327 to - 217, see Fig.
I) was incubated with I /-lg of 12-DAP endospeml nuclear proteins in the presence of increasing amount of unlabeled
competitor DNAs. Lanes (+ ) a nd ( - ) are controls with and without endosperm nuclear proteins in the presence of no
competitor DNA, respectively. Pa rts a, band c contained increasing amounts of unlabeled fragments 4, 8' and 2, respectively.
La nes I, 2, 3, a nd 4 contained 0, 25, 125, 350 ng of competitor DNAs, respectively. A band representing the protein/DNA
complex is missing in la ne c4 due to misha ndling of the gel.
Regulatory Region of Maize y-Zein Gene
148
Mol. Cells
Sequence Comparison of the 5' Flanking
Region of Gamma-Zein Gene from W64A+ and QPM
ATATATCATATATATATATATACATATATATATAT
~7
_______
_____
wild-type CATATGTTTTATTAAAACAAAATTIATC AAACCGTAGCAATGCACGGGCATATAA
mutant CATATGTTTTATTAAAACAAAATTIATC AAACCGTAGCAATGCACAGGC
-
ATATATATATATATATATATATATATATATATATATATATATATATAATAT
Figure 4. Compared to the inbred line W64A + (wild type), the promoter region of the gamma-zein gene from the modified
opaque-2 QPM line (mutant) has an additional AT-rich sequence. Shown are 9O-bp Ndel/Spel fragment (from -847 to
-757) of the gamma-zein promoter from the inbred line (wild type) and the lOO-bp NdeI fragment (from -847 to -747)
of the gamma-zein gene from the modified opaque-2 line (mutant).
Ndel
I
Msel
I.~.~
CATATGTTTTATTAAAACAAAATTTATCATATCATATATATATATATACATATATATATAT~A~T~CGG
-847
~
-748
/
B
F
-
Figure 5. Chemical footprinting of the 166-bp Ndel/Sau3AI fragment from -847 to -68 1 (Fig. 2). F, free DNA unbound
with nuclear proteins; B. DNA bound by nuclear proteins. The protein-binding region extends from -843 to -82 1. DNA
sequence between - 847 and -748 is shown. The open box within the footprinted region corresponds to the sequence
TTAAAACAAM which is also found in the proximal binding site from -327 to -235 (Fig. I). The arrows indicate
an inverted sequence repeat in the binding site. AT-rich sequence downstream of the footprinted region is underlined.
for the protein factor, footprinting experiments were
performed. Because DNase I digestion resulted in a
footprint with a poorly defined sequence, a chemical
footprinting analysis was attempted. The DNA fragment 8' (i.e. l66-bp NdeIlSau3Al fragment, see Fig.
2) was incubated with 12-DAP endosperm nuclear
proteins and then subjected to chemical footprinting
as described in Materials and Methods. This reaction
identified a sequence of approximately 30 bp that
spans from -839 to -8 10 (Fig. 4). The protein-binding region contains the sequence TTAAAACAAAA,
which is also found in the proximal binding site from
- 327 to - 235 (Fig. 1). The binding region also contains an inverted seq u ence repeat TGTTTTATTAAAACA with unknown significance.
We sequenced 5' flanking region of a gamma-zein
genes from a wild type maize inbred line (W64A +),
a standard opaque-2 line (W64A02), and a modified
opaque-2 genotype (QPM Blanco Dentado) (unpublished data). Comparison of the three sequences revealed that they are approximately 95% conserved for the
first thousand nucleotide (1 kb) upstream of the transcription start site, whereas sequences further upstream
of the conserved region are divergent. The fact that
the gamma-zein gene expression in the three lines
are regulated in a similar manner (tissue-specific and
temporal) suggests that the cis-acting regulatory elements exist in this conserved 1.0-kb region. Within this
conserved region there is an extra AT-rich sequence
inserted between base pairs - 847 and - 681 in the
modified opaque-2 mutant. The protein-binding sequence lies approximately 10 bp 5' to this AT-rich insertion (Fig. 5). To determine whether the extended ATrich sequence in the modified opaque-2 line affects
binding of the nuclear protein to the recognition site,
competitive binding experiments were performed,
where the 90-bp NdeI/SpeI fragment (from - 847 to
- 757) from the wild type gamma-zein gene (Fig. 4)
was radiolabeled and incubated with endosperm nuclear proteins in the presence of increasing amounts
of competitor DNAs. As shown in Fig. 6, the binding
site fro m the modified opaque-2 line which contains
Jae-Seong So et at.
Vol. 1 (1991)
COMPETITION EXPERIMENT
c
A
B
- + 1 2 3 4 1 2. 3 4 1 2 3 4
-------.. -
Figure 6. Competitive gel retardation assay. The binding site
of the gamma-zein gene from the modified opaque-2 line
has a higher affinity for the nuclear protein than the site
from the wild type. The 9O-bp Ndel/Spel fragment from fragment 8' (approximately 10 femtomoles) was incubated with
12-DAP endosperm nuclear proteins (2 J.lg) in the presence
of increasing amount of competitor DNAs. Control lanes
( +) and (-) are with and without nuclear proteins in the
absence of competitor DNA A DNA band migrating slower
than the free probe DNA in lane (-) is an artifact, and
is probably due to the secondary structure of the probe
DNA Increasing a mounts of unlabeled competitor DNAs
were added in addition to other components in the binding
reaction. C, fragment 3 (Fig. 1); A, 9O-bp Ndel/Spel fragment
(fro m - 847 to -757) of the gam ma-zein gene fro m the
wild type inbred line W64A +; B, loo-bp NdeI fragment
(from - 847 to -747) of the gamma-zein gene from the
modified opaque-2 line OPM, which corresponds to the fragment A DNA sequences of the fragments A and Bare
shown in Figure 4. Lanes I, 2, 3 and 4 contained 100, 200,
400, and 1000 femtomoles of competitor DNAs, respectively.
an additional AT-stretch has approximately 5 times
higher affinity for the protein than the site from the
wild type inbred line W64A +. The addition of 100fold molar excess of unlabeled wild type sequence to
the binding reaction completely abolished the protein/ DNA complex (lane A4), while the addition of
20-fold molar excess of unlabeled mutant sequence
showed equal degree of competition (lane B2). However, the addition of l00-fold molar excess of unlabeled
fragment 3 (Fig. 1) did not affect the complex formation (lane C4).
Whether or not the expanded AT stretch enhances
gamma-zein gene transcription in vivo remains to be
established. However, it is not unprecedented that the
longer AT stretch up-regulates downstream gene acting
as a positive activator. DNA sequences of two yeast
promoter up-mutants revealed that the mutant phenotype was associated with an increase in length of a
poly(dA-dT) tract 222 bp upstream of the gene (Russell et al., 1983). In addition naturally occurring poly
(dA-dT) sequences were found to act as upstream pro-
149
moter elements for constitutive transcnptlOn in yeast
(Struh1, 1985). In the latter study, the higher transcription level of the gene downstream of the AT-rich sequence was found to be due to a longer po1y(dA-dT)
region. In this regard an interesting observation has
recently been reported with a seed protein gene (Bustos et al., 1989). An AT-rich sequence found upstream
of a French bean beta-phaseolin gene interacted with
a nuclear protein and had properties of an enhancer
element as it increased the transcription of the downstream gene in an orientation independent manner.
Acknowledgment
We wish to thank Dr. Mark Shotwell for his comment on the manuscript and help in preparing figures.
References
Allen, R. D., Bernier, F., Lessard, P . A , and Beachy,
R. N . (1989) Plant Cell 1, 623-631
Bradford, M. M. (1976) Anal. Biochem. 72, 248-254
Bustos, M. B., Guiltman, M. J., Jordano, J., Begum,
D., Kalkan, F. A , and Hall, T. C. (1989) Plant Cell
1, 839-853
Fried, M ., and Crothers, D. M. (1981) Nuc. Acids Res.
9, 6505-6525
Jacobsen, K , Lausen, N. B., Jensen, E. 0 ., Marcker,
A , Poulsen, c., and Marcker, K A (1990) Plant Cell
2, 85-94
Kodrzycki, R., Boston, R. S., and Larkins, B. A (1989)
Plant Cell 1, 105-114
Kuwabara, M. D., and Sigman, D. S. (1987) Biochem.
26, 7234-7238
Larkins, B. A , Lending, C. R., Wallace, J. c., Galili,
G ., Kawata, E. E., Geetha, K B., Kriz, A L., Martin,
D. N., and Bracker, C. E. (1989) The Molecular Basis
of Plant Development (Goldberg, R. B. ed) pp. 109120, Alan R. Liss, Inc., New York
Maier, U. -G., Brown, J. W. S., Schmitza, S., Schwall,
M ., Dietrich, G., and Feiz, G . (1988) Mol. Gen. Genet.
212, 241-245
Maier, U. -G., Brown, J. W. S., Toloczyki, c., and Feix,
G . (1987) EMBO J 6, 17-22
Maniatis, T., Fritsch, E. F., and Sambrook, J. (1982)
Molecular cloning, a Laboratory Manual, Cold Spring
Harbor Laboratory, Cold Spring Harbor, NY
Mitchell, P. J. and Tjian, R. (1989) Science 245, 371378
Revzin, A (1989) BioTech. 7, 346-355
Russell, D . W., Smith, M., Cox, D., Williamson, V.
M., and Young, E. T. (1983) Nature 304, 652-654
Struhl, K (1985) Proc. Nat!. Acad. Sci. U S. A. 82, 84198423
Wallace, J. W., Lopes, M. A , Pavia, E., and Larkins,
B. A (1990) Plant Physiol. 92, 191-196