Download Ten novel interaction partners for the histone H2A protein

Ten novel interaction partners for the histone H2A protein
identified with the split-ubiquitin system
Goh, A.L.H. and Lehming, N.
Department of Microbiology, Faculty of Medicine, National University of Singapore
Block MD4, 5 Science Drive 2, Singapore 117597
ABSTRACT
The split-ubiquitin system detects protein-protein interactions in vivo. It allows the screening of
binding partners for a bait protein of interest. For this project, the bait protein of interest was histone
2A (H2A), a component of the histone octamer found in chromatin. Chromatin is known to be
involved in the regulation of gene expression. A library of genomic Saccharomyces cerevisiae DNA
fragments fused to the N-terminal half of ubiquitin was transformed into an S. cerevisiae strain
carrying the bait protein H2A (encoded by the gene HTA1) fused to the C-terminal half of ubiquitin.
Protein interactions with the bait protein resulted in a native-like ubiquitin being formed, allowing
for survival in selective media. Sequencing of the library inserts of the selected clones was carried
out, and an internet BLAST search was conducted to identify the interacting proteins. The screen
identified 11 proteins as interacting partners for H2A. One of these proteins had been previously
known to bind H2A, while 10 of these proteins were novel interactors for H2A. Two of these novel
proteins, Cac1 and Paf1, have potential roles in gene expression in association with H2A.
INTRODUCTION
Protein-protein interactions play an important role in almost all cell activities. The focus of this
research was to screen for previously unknown binding partners of the well-characterised protein
histone 2A (H2A). In this screen, H2A was expressed from the HTA1 allele, and is thus referred to
as Hta1. The modification of histones, such as acetylation, has been found to be involved in relaxing
the chromatin structure and allowing transcription factors greater access to genes (Lodish et al.,
2000).
The split-ubiquitin system was developed by Johnsson and Varshavsky (1994) and makes use of
the highly specific cleavage by ubiquitin-specific proteases (UBPs). The ubiquitin molecule is split
into two: the N-terminal half (Nub) and the C-terminal half (Cub). A reporter enzyme, RUra3p, is
attached downstream of the Cub. The bait protein is fused to the Cub–RUra3p moiety, while the prey
is fused to the Nub portion. Upon interaction of bait and prey, the two halves of ubiquitin are
brought together in a native-like conformation, which allows the UBPs to recognize and cleave the
RUra3p enzyme from the Cub.
According to the N-end rule of protein degradation, proteins that carry a destabilizing N-terminal
amino acid are rapidly degraded (Varshavsky, 1996). The N-terminal amino acid of the reporter
enzyme RUra3p has been changed to the destabilizing arginine (R) residue, which allows it to be
rapidly degraded when cleaved off. Since the Ura3p enzyme converts the compound 5-fluoro-orotic
acid (FOA) into a toxic metabolite, the absence of RUra3p would confer the yeast cell with the
ability to grow on plates containing FOA. Hence, the interaction between bait and prey proteins can
be detected by resistance to FOA.
MATERIALS AND METHODS
Split-Ubiquitin Screen The Nub fusion library has been described in (Laser et al., 2000). The Cub
vector consisted of Hta1 fused to the C-terminal half of ubiquitin followed by a modified Ura3p
with an arginine in position one (Hta1-Cub-RUra3p). Both vectors were transformed into JD52 yeast
cells using fish sperm DNA as carrier.
Droplet Assay The Nub vectors obtained from clones picked in the split-ubiquitin screen were
transformed into JD52 yeast cells containing the Hta1-Cub-RUra3p vector and grown on a nonselective plate. The yeast cells were picked and serial diluted to 10-6 of the original concentration.
All six dilutions were then plated out on selective plates using 5 µl of each dilution in columns of
decreasing concentration.
Cycle Sequencing The cycle sequencing reaction consisted of 4µl BigDye® Terminator (v.3.1)
ready-reaction mix (Applied Biosystems Inc.), 100-250 ng template DNA, 1.6 pmol primer, and
deionized
water
to
a
total
reaction
volume
of
10µl.
5’
Nub
(5’GCCAAGCTTATGCAGATTTTCGTCAAGAC) was used as the forward primer and 1995
(5’CTACCAACGATTTGACCCTT) as the reverse primer. For two forward sequences that did not
yield results initially, a different forward primer, Nub 129 (5’GGATCCCTCCAGGTAACTCG),
was used.
RESULTS AND DISCUSSION
Screening of S. cerevisiae library for interactions with Hta1
Plates lacking lacking tryptophan (W-) and leucine (L-) but containing FOA (termed FWL plates)
were used to select for interacting proteins. The Cub vector contained the TRP1 gene and the Nub
vector contained the LEU2 gene. The transformed yeast cells were also plated on FWL plates
containing 100µM CuSO4. The Cub vector contained a Cu2+ inducible promoter (CUP1). Adding
CuSO4 to the plate increased the amount of Cub–RUra3p fusion proteins produced, and selected for
clones with high interaction strength since a strong Nub fusion protein interaction was needed to
release the higher number of RUra3p enzymes to be degraded.
13 clones were obtained from the split-ubiquitin screen. However, all of the clones were
obtained from the plates without CuSO4, indicating that the interaction strength of these Nub fusion
proteins with Hta1 was not very high.
A control plating was also done on non-selective media consisting of SD plates lacking
tryptophan and leucine (termed WL plates). This plating was carried out in dilutions of 10-3, 10-4,
10-5and 10-6. Only the 10-3 dilution plating exhibited growth. Eight colonies were present, which
translates to a total of (8 x 103) or 8000 clones transformed with both the Cub and Nub fusion vectors.
The proportion of clones with interacting proteins to the total number transformed was 13 out of
8000 clones.
The 13 clones were designated S1 to S13. The Nub fusion vectors obtained from the 13 clones
were then transformed into E. coli cells to amplify the vectors. The transformed cells were plated
onto selective LB (Luria-Bertani) plates containing chloramphenicol. Two single colonies from
each of the plates were picked and grown in LB broth containing chloramphenicol. A total of 26
DNA mini preparation was then carried out to purify the Nub vectors from the E. coli cells.
The restriction enzymes NotI and HindIII were used to cut the library inserts from the Nub fusion
vector, and the digested DNA was separated on a 1% agarose gel with a pGEM size marker. A
negative control consisting of an Nub vector without a genomic DNA insert was included. One of the
13 clones exhibited different insert sizes among its duplicates. Sample 18 had a different insert size
from sample 17, and they both came from the same clone. Thus, sample 18 was designated as a new
clone S14, since its fusion protein might also have had interaction with Hta1.
Testing of plasmid linkage
To test plasmid-linkage, the Nub vectors from the 14 clones were transformed into JD52 yeast
cells containing the Hta1-Cub-RUra3p fusion protein. The transformants were plated equally onto
FWL plates and WL plates. The proportion of colonies that grew on the selective FWL plate
compared to the non-selective WL plate was calculated. A negative control, the Nub vector without
any insert (PACNX-NubIBC1), was included to check for any background FOA resistance not due
to Cub and Nub fusion protein interaction. A positive control, the Nub vector expressing the Nub-Htb1
fusion protein (PACNX-NubIBC-Htb1) was also included. Htb1 is histone 2B (H2B) encoded by
allele 1 of the HTB gene, and it is known to interact with Hta1.
The negative control displayed very low background growth on the FWL plate, with only one
colony compared to 200 on the WL plate. For the positive control, more growth occurred on the
FWL plate than on WL. Growth was exhibited on both FWL and WL plates for all the clones except
for S3 where both samples 5 and 6 did not exhibit any growth on the FWL plates. This showed that
no interaction between the Cub and Nub fusion proteins occurred in this clone. It was probable that in
the original screen, some other factor had played a part in conferring FOA resistance and allowed
for a false positive result.
The rest of the clones, except S3, exhibited a range of results between 18% and 100% growth on
the FWL plate compared to the WL plate. All of these were deemed to be the result of plasmidlinked Cub and Nub fusion protein interactions, since they all had a percentage of growth
significantly higher than the negative control background (0.5%). Thus, it was confirmed that 13 out
of the 14 clones were true positives for Hta1-Cub-RUra3p and Nub fusion protein interaction.
Comparing strength of protein-protein interaction
The strength of protein-protein interaction was tested using a droplet assay. Ten-fold serial
dilutions were plated on different media: WL plates, FWL plates, SD containing 100 µM CuSO4
with FOA and lacking tryptophan and leucine (100 FWL plates), SD lacking uracil, tryptophan and
leucine (UWL plates), and lastly, SD containing 100 µM CuSO4 and lacking uracil, tryptophan and
leucine (100 UWL plates). The uracil-depleted plates selected for yeast cells with no Nub and Cub
fusion protein interaction. Since the yeast strain used was URA3 deficient, the functional Ura3p
enzyme was needed to survive on plates lacking uracil.
Each of the clones was scored from zero to six according to degree of growth on each plate, by
counting the number of serial dilutions for which considerable growth had occurred. Formulae
which take into consideration background growth were used to calculate interaction strength.
To calculate interaction strength on the UWL plates, we used the formula:
[(Score of clone on WL) – (Score of clone on UWL)] – [(Score of Nub on WL) – (Score of Nub on UWL)]
For the FWL plates, the formula used was:
[(Score of clone on FWL) – (Score of clone on WL)] – [(Score of Nub on FWL) – (Score of Nub on WL)]
Among all the clones, the ones with the strongest Nub fusion protein interaction with Hta1Cub-RUra3p were S7 and S13, with an average relative score of 2.8. The weakest interaction
occurred in S12, with a score of 1.0. Nub-Htb1 had the highest average score of 3.3. All the other
clones had averages scores between 1.0 and 2.8. Thus, although all the clones demonstrated
interaction between their Nub fusion proteins and Hta1-Cub-RUra3p, none of them possessed an
interaction strength as high as a known binding protein of Hta1.
Characterisation of proteins
Before sequencing could be done, a DNA maxi preparation was carried out to obtain a high
amount of good quality DNA purified from E. coli for better sequencing results. Cycle sequencing
was carried out, and an internet BLAST search was conducted in the Saccharomyces Genome
Database (genome-www.stanford.edu/Saccharomyces) to check for sequence identity with known
genes. The sequence identity from one clone (S12) could not be determined. S9 expressed a protein
that was a known interactor with Hta1. Out of the remaining 11 clones, S6 and S11 expressed the
same protein. Thus, only 10 novel proteins were characterised out of the 13 clones.
Proteins that are not located in the nucleus can be ruled out from directly binding Hta1 since
histones are only present in the nucleus. For these proteins, other factors might have led to their
interaction with Hta1. For example, it is possible that they interacted with the positively-charged
Hta1 because of the presence of large numbers of negatively-charged amino acids. This could
explain the high interaction strength of Dap1 found in the membrane, since it possessed a number of
negatively-charged aspartic acid and glutamic acid molecules in the interacting portion with Hta1.
So far, the most likely candidates for further research were the Cac1 and Paf1 proteins due to
their location within the nucleus and their described roles in transcription. Both these proteins also
had a relatively high interaction score of 2.0 and 2.8 respectively. Cac1, the largest subunit of the
chromatin assembly factor-I (CAF-I), is known to play a role in nucleosome assembly and mediates
histone acetylation patterns that maintains the transcriptionally repressed state of DNA (Monson et
al., 1997). Thus, the interaction of Cac1 with H2A might provide new clues regarding this process.
Paf1 is a RNA polymerase II associated factor that is involved in the elongation phase of
transcription (Squazzo et al., 2002). The Paf1 complex might also be involved in disrupting the
reassembly of chromatin structure after the passage of RNA polymerase II through the nucleosomes
during transcription elongation (Formosa et al., 2002). Thus, the interaction of Paf1 with H2A
might have implications for its role in transcription.
CONCLUSION
The screen identified 10 novel proteins as interacting partners for H2A. Two of these novel
proteins, Cac1 and Paf1, have potential roles in gene expression in association with H2A. Future
work, such as using a GST pull-down to test for direct binding to Hta1 in vitro, is needed to provide
more information regarding the possible roles of H2A interaction with Cac1 and Paf1.
ACKNOWLEDGEMENTS
I thank my supervisor, Dr. Norbert Lehming for all the help and advice provided repeatedly. I
am also indebted to Wee Leng and Boon Shang for the demonstrations of techniques and protocols.
Thanks also go out to Fuji, Lyanne, Rashmi, Hong Peng, Jen Yen and Seok Shin for all their help
and support, and most importantly, for making the lab such a pleasant and fun place to work in.
REFERENCES
Formosa, T., Ruone, S., Adams, M.D., Olsen, A.E., Eriksson, P., Yu, Y., Rhoades, A.R., Kaufman,
P.D., and Stillman, D.J. (2002). Defects in SPT16 or POB3 (yFACT) in Saccharomyces
cerevisiae cause dependence on the Hir/Hpc pathway: Polymerase passage may degrade
chromatin structure. Genetics 162, 1557–1571.
Johnsson, N., and Varshavsky, A. (1994). Split ubiquitin as a sensor of protein interactions in vivo.
Proc. Natl. Acad. Sci. USA 91, 10340–10344.
Laser, H., Bongards, C., Schuller, J., Heck, S., Johnsson, N., and Lehming, N. (2000). A new
screen for protein interactions reveals that the Saccharomyces cerevisiae high mobility group
proteins Nhp6A/B are involved in the regulation of the GAL1 promoter. Proc. Natl. Acad. Sci.
USA 97, 13732–13737.
Lodish, H., Berk, A., Zipursky, S.L., Matsudaira, P., Baltimore, D., and Darnell, J.E. (2000).
Molecular Cell Biology. (4th Edition). New York: W H Freeman & Co.
Monson, E.K., De Bruin, D., and Zakian, V.A. (1997). The yeast Cac1 protein is required for the
stable inheritance of transcriptionally repressed chromatin at telomeres. Proc. Natl. Acad. Sci.
USA 94, 13081–13086.
Squazzo, S.L., Costa, P.J., Lindstrom, D.L., Kumer, K.E., Simic, R., Jennings, J.L., Link, A.J.,
Arndt, K.M., and Hartzog, G.T. (2002). The Paf1 complex physically and functionally associates
with transcription elongation factors in vivo. EMBO Journal 21(7), 1764-1774.
Varshavsky, A. (1996). The N-end rule: functions, mysteries, uses. Proc. Natl. Acad. Sci. USA 93,
12142–12149.