Download Chapter 13: Genetic Technology

Chapter 14: The Human Genome
Making a Pedigree
 Pedigree – a graphic representation of genetic inheritance
 Symbols of a Pedigree
 Male
 Female
 Death
 Married
 Children
 Twins
 Affected Individuals
 Carrier
Analyzing a Pedigree
I
II
III
1
Recessive Alleles
 Genetic Disorders – the harmful effects produced by mutated genes
 Most genetic disorders are caused by recessive alleles
 Some are common in certain ethnic groups
 Cystic Fibrosis
 Recessive disorder
 Carried on chromosome #7
 Fairly common in white Americans
 1 in 20 carrier the allele
 1 in 2000 have the disorder
 A defective protein causes thick mucus to accumulate in the lungs and digestive
tract
 Usually don’t survive to adulthood
 New drug therapies and special diets have raised the life expectancy
 Tay-Sachs
 Recessive disorder
 Affects central nervous system
 Lipids build up in brain
 Death in early childhood
 Common in US among Jews
 Phenylketonuria (PKU)
 Recessive disorder
 Carried on chromosome #12
 Failure of brain to develop in infancy
 Phenylalanine is not broken down so it builds up and causes mental retardation
 Common in people whose ancestors came from Norway or Sweden
 Newborns appear normal until they drink milk
 PKU test is given at birth
 Infants are given diets low in phenylalanine until their brains are fully developed
Dominant Alleles
 A single dominant allele inherited from one parent is all that is needed to show the
trait
 Huntingtons Disease
 Dominant disorder
 Breakdown of certain areas of the brain
 Uncontrollable movements
 Onset usually occur between 30-50
 Achondroplasia
 Dominant disorder
 dwarfism
2
Codominant Alleles
 Sickle Cell Anemia
 Recessive disorder
 Most common in black Americans
 1 in 12 African Americans is heterozygous for the trait
 In homozygous individuals the oxygen carrying protein hemoglobin is defective
 This causes red-blood cells to be sickle shape and reduces there oxygen
carrying capacity
 Heterozygous individuals have both normal and sickle shaped red-blood cells
because they are codominant
Sex Determination
 23 pairs of chromosomes
 22 pairs are autosomes
 1 pair is sex chromosomes
 Female XX
 Male XY
Sex-Linked Inheritance
 Sex-linked traits – traits controlled by genes on sex chromosomes
 Any allele on the X chromosome of a male will not be masked by a corresponding
allele on the Y chromosome
 If a son receives a recessive X chromosome from mom he will express the recessive
phenotype because he has no chance of inheriting a dominant allele from his father
to mask the recessive allele
 More males have sex-linked disorders
 Red-Green Color Blindness
 Sex linked recessive
 Can’t tell the difference between red and green
 Hemophilia
 Sex linked recessive
 Failure of blood to clot
 Muscular Dystrophy
 Sex linked recessive
 Wasting away of muscles
X-Chromosome Inactivation
 If one X is enough how do cells adjust to extra X in females?
 In females 1 X is randomly switched off
 Turned off X is called a Barr body
 Example: Calico Cat
 In cats the gene for fur color is on the X chromosome
 1X could have the allele for orange and the other the allele for black
 So depending on which allele is turned off or on gives the different colors
 All cats with 3 colors are female
3
14-2 Human Heredity
 Karyotype – a chart of chromosome pairs that is valuable in pinpointing unusual
chromosome numbers in cells
 A picture is taken of chromosomes in metaphase. Why?
 Because they are coiled up tightly and lined up so they are very visible.
 They are cut out and arranged in pairs according to length and location of the
centromere
Chromosomal Disorders
 Disorders caused by nondisjunction
 Down Syndrome – Trisomy 21
 Some degree of mental retardation
 Incidence of down syndrome births is higher in older mothers especially over 40
 3 chromosomes on pair number 21
 Patau Syndrome – Trisomy 13
 Multiple abnormalities
 Condition usually fatal by one year of age
 Edward Syndrome – Trisomy 18
 Varying degrees of mental retardation
 Usually fatal by three months of age
Sex Chromosome Disorders
 Disorders caused by nondisjunction
 Turner Syndrome
 X ____
 Females
 Sterile
 Shorter, stocky
 Triple X
 XXX
 Females
 Usually fertile
 Abnormalities vary
4
 Klinefelter Syndrome
 XXY
 Males
 Sterile
 May be mentally retarded
 Slight breast development
 Underdeveloped genitalia
 Sparse body hair
 Jacob Syndrome
 XYY
 Males
 Sterile
Environmental Influences
 As an organisms develops many factors can influence how the gene is expressed or
if it is expressed at all
 Temperature, nutrition, light, chemicals can all influence gene expression
 Ex. Leaves of different sizes
 Ex. Himalayan rabbit fur color
 Ex. Arctic Fox fur color
5
Chapter 13: Genetic Engineering
13.2 Manipulating DNA
Molecular Biology
 DNA Fingerprint – a sequence of bands that shows a persons DNA sequence
 How to make a DNA Fingerprint
1. DNA Extraction
 Cell is opened and the DNA is separated from the other cell parts
2. Cutting DNA
 DNA is so long we cut it into smaller fragments
 Restriction Enzymes – cut DNA at a specific sequence of nucleotides
 Types of Restriction Enzymes
 EcoRI - C T T A A G
GAATTC
 Bam I - C C T A G G
GGATCC
 Hae III - C C G G
GGCC
3. Separating DNA
 Gel Electrophoresis – a technique for separating DNA
 DNA is negatively charged
 Load DNA into gel
 Apply electric voltage to gel
 DNA will move through gel to positive
 Smaller DNA fragments move faster and further
 How do you end up with different size fragments that are unique to each individual?
 Tandem Repeat – region of a chromosome that contains multiple copies of a
DNA sequence
 The origin and significance of tandem repeats is a mystery
 For forensic scientists they offer a means of distinguishing one individual from
another through DNA fingerprinting
 30% of human genome is composed of tandem repeats.
 Tandem repeats seem to act as filler or spacers between the gene regions of
DNA
6
Polymerase Chain Reaction (PCR)
 PCR – the process of making many copies of genes
 Heat DNA to separate two strands
 As it cools DNA polymerase starts making copies
 Repeat this process and end up with millions of copies
7
13-3 Cell Transformation
 Transformation – one organism is changed by a gene or genes from another
organism
 Genetic Engineering – method of cutting DNA from one organism and inserting the
DNA into another organism
 Recombinant DNA – DNA made by recombining fragments of DNA from different
sources
 Plasmid
 Extra circular DNA found in some bacteria
 Very useful for DNA transfer from one organism into another
 Process of Transformation
1. Cut out gene of interest with restriction enzyme
2. Use same restriction enzyme to cut plasmid
 This creates ends on each that will match up
3. Combine the gene of interest with the plasmid
4. Place the recombinant DNA into a bacteria cell
5. Bacteria will replicate this new DNA and make many copies of the gene of
interest
13-4 Applications of Genetic Engineering
 When recombinant DNA is put into a host that organism will use the foreign DNA as
if it were its own.
 Transgenic Organisms – contain functional foreign DNA
 Ex. Glowing bacteria
8
Application of DNA Technology
 Transgenic bacteria in agriculture
 A bacteria on strawberry plants promotes frost damage on leaves. The gene for
this protein is removed and frost damage is prevented.
 A bacteria that lives in soil and in the roots of plants can be engineered to
increase the rate of conversion of atmospheric nitrogen to nitrates, a natural
fertilizer, to help cut back on fertilizer use and cost
 Transgenic bacteria in industry
 Used to clean up oil spills
 Extract valuable minerals from ores
 Transgenic bacteria in medicine
 The production of growth hormone to treat dwarfism
 Human insulin used to treat diabetes
 Transgenic plants
 Have been genetically engineered to resist herbicides, produce internal
pesticides or increase their protein production.
 Produce rice with vitamin A
 In 2000 52% of soybeans and 25% of corn grown in US was genetically modified
 Transgenic Animals
 Make animals grow faster and produce leaner meat
 Trying to produce chickens resistant to bacterial infections that cause food
poisoning
 Cows produce different human proteins in their milk
Cloning
 Clone – genetically identical offspring produced from a single cell
 In 1997 Scottish scientist Ian Wilmut cloned first mammal, a sheep named Dolly
9
14-3 Human Molecular Genetics
Human Genome Project
 Human Genome Project
 An international effort to completely map and sequence the human genome
 Started in 1990 and completed in 2000
 How did they do it?
 First determined markers – a sequence of bases in widely separated regions
of DNA
 Cut DNA into random fragments
 Determined sequences of the fragments
 Computers found areas of overlap between the fragments
 One surprise was how few genes humans have
 Fruit fly – 14,000
 Tiny worm – 20,000
 Human – 25,000






A human diploid cell contains more than 3 billion base pairs
Only about 2% of the DNA in your chromosomes functions as genes
The average human gene consists of about 3000 base pairs
The largest gene in the human genome has more than 2 million base pairs
Chromosome 22 and 21 were the first 2 human chromosomes sequenced
Chromosome 22
 Contains approximately 43 million base pairs
 545 genes
 1 causes leukemia
 1 neurofibromatosis
 Chromosome 21
 Approximately 32 million base pairs
 225 genes
 Lou Gehrigs disease (ALS) – loss of muscle control due to destruction of nerves
in the brain and spinal cord
10
Chapter 14: The Human Genome
Making a Pedigree
 Pedigree –
 Symbols of a Pedigree
 Male
 Female
 Death
 Married
 Children
 Twins
 Affected Individuals
 Carrier
Analyzing a Pedigree
I
II
III
11
Recessive Alleles
 Genetic Disorders –
 Most genetic disorders are caused by _______________ alleles
 Some are common in certain ethnic groups
 Cystic Fibrosis
 Recessive disorder
 Carried on chromosome ________
 Fairly common in __________ _______________
 1 in ________ carrier the allele
 1 in ________ have the disorder
 A defective ____________ causes thick mucus to accumulate in the lungs and
digestive tract
 Usually don’t survive to _______________
 New drug therapies and special diets have raised the life expectancy
 Tay-Sachs
 Recessive disorder

 ____________ build up in brain
 Death in early childhood
 Common in US among ____________
12
 Phenylketonuria (PKU)
 Recessive disorder
 Carried on chromosome __________

 __________________ is not broken down so it builds up and causes mental
retardation
 Common in people whose ancestors came from Norway or Sweden
 Newborns appear normal until they drink ____________
 PKU test is given at birth
 Infants are given diets low in phenylalanine until their brains are fully developed
Dominant Alleles
 A single dominant allele inherited from one parent is all that is needed to show the
trait
 Huntingtons Disease
 Dominant disorder

 Uncontrollable movements
 Onset usually occur between ______-______
 Achondroplasia
 Dominant disorder

13
Codominant Alleles
 Sickle Cell Anemia
 Recessive disorder
 Most common in ____________ ________________
 1 in ______ African Americans is _________________ for the trait
 In homozygous individuals the oxygen carrying protein hemoglobin is defective
 This causes red-blood cells to be sickle shape and reduces there __________
carrying capacity
 Heterozygous individuals have both __________ and __________ shaped redblood cells because they are codominant
Sex Determination
 ______ pairs of chromosomes
 22 pairs are _______________
 1 pair is ________ chromosomes
 Female ________
 Male ________
Sex-Linked Inheritance
 Sex-linked traits –
 Any allele on the X chromosome of a male will not be masked by a corresponding
allele on the Y chromosome
 If a son receives a recessive X chromosome from mom he will express the recessive
phenotype because he has no chance of inheriting a dominant allele from his father
to mask the recessive allele
 More __________ have sex-linked disorders
14
 Red-Green Color Blindness
 Sex linked _______________
 Can’t tell the difference between red and green
 Hemophilia
 Sex linked recessive

 Muscular Dystrophy
 Sex linked recessive

X-Chromosome Inactivation
 If one X is enough how do cells adjust to extra X in females?
 In females 1 X is randomly ____________ ________
 Turned off X is called a __________ __________
 Example: Calico Cat
 In cats the gene for fur color is on the X chromosome
 1X could have the allele for __________ and the other the allele for __________
 So depending on which allele is turned off or on gives the different colors
 All cats with 3 colors are ____________
15
14-2 Human Heredity
 Karyotype –
 A picture is taken of chromosomes in metaphase. Why?

 They are cut out and arranged in pairs according to length and location of the
centromere
Chromosomal Disorders
 Disorders caused by nondisjunction
 Down Syndrome – ____________ ______
 Some degree of mental retardation
 Incidence of down syndrome births is higher in older mothers especially over 40
 ______ chromosomes on pair number 21
 Patau Syndrome – ____________ ______
 Multiple abnormalities
 Condition usually fatal by one year of age
 Edward Syndrome – ___________ ______
 Varying degrees of mental retardation
 Usually fatal by three months of age
16
Sex Chromosome Disorders
 Disorders caused by nondisjunction
 Turner Syndrome




 Triple X




 Klinefelter Syndrome



 May be mentally retarded
 Slight __________ development
 Underdeveloped ____________

17
 Jacob Syndrome



Environmental Influences
 As an organisms develops many factors can influence how the gene is expressed or
if it is expressed at all
 Temperature, nutrition, light, chemicals can all influence gene expression
 Ex.
 Ex.
 Ex.
18
Chapter 13: Genetic Engineering
13.2 Manipulating DNA
Molecular Biology
 DNA Fingerprint –
 How to make a DNA Fingerprint
1. DNA Extraction
 Cell is opened and the _______ is separated from the other cell parts
2. Cutting DNA
 DNA is so long we cut it into smaller fragments
 Restriction Enzymes –
 Types of Restriction Enzymes
 EcoRI - CTTAA
Ex: ACTGCTTAAGGCATTGCCTTAACAGGCTA
 Bam I - CCTAG
Ex: GCTTACCCTAGATGACGTTACTTACAGGC
 Hae III - CCGG
Ex: CCGATACGCTCCGGACTACCGGATCCGGAT
3. Separating DNA
 Gel Electrophoresis –
 DNA is _______________ charged
 Load DNA into gel

 DNA will move through gel to _______________
 _______________ DNA fragments move faster and further
19
 How do you end up with different size fragments that are unique to each individual?
 Tandem Repeat –
 The origin and significance of tandem repeats is a mystery
 For forensic scientists they offer a means of distinguishing one individual from
another through DNA fingerprinting
 _______ of human genome is composed of tandem repeats.
 Tandem repeats seem to act as filler or spacers between the gene regions of
DNA
Polymerase Chain Reaction (PCR)
 PCR –
 Heat DNA to separate two strands
 As it cools DNA polymerase starts making copies
 Repeat this process and end up with millions of copies
20
13-3 Cell Transformation
 Transformation –
 Genetic Engineering –
 Recombinant DNA –
 Plasmid

 Very useful for DNA transfer
 Process of Transformation
1. Cut out gene of interest with _______________ enzyme
21
2. Use same restriction enzyme to cut _______________
 This creates ends on each that will match up
3. Combine the gene of interest with the plasmid
4. Place the recombinant DNA into a _______________ ________
5. Bacteria will _______________ this new DNA and make many copies of the
gene of interest
13-4 Applications of Genetic Engineering
 When recombinant DNA is put into a host that organism will use the foreign DNA as
if it were its own.
 Transgenic Organisms –
 Ex.
Application of DNA Technology
 Transgenic bacteria in agriculture
22
 A bacteria on strawberry plants promotes frost damage on leaves. The gene for
this protein is removed and frost damage is prevented.
 Another bacteria that lives in soil and in the roots of plants can be engineered to
increase the rate of conversion of atmospheric nitrogen to nitrates, a natural
fertilizer, to help cut back on fertilizer use and cost
 Transgenic bacteria in industry
 Used to clean up ______ __________

 Transgenic bacteria in medicine
 The production of growth hormone to treat ____________

 Transgenic plants
 Have been genetically engineered to resist herbicides, produce internal
pesticides or increase their protein production.

 In 2000 _______ of soybeans and _______ of corn grown in US was genetically
modified
 Transgenic Animals
 Make animals grow faster and produce leaner meat
 Trying produce chickens resistant to bacterial infections that cause food
poisoning
 Cows produce different human _______________ in their milk
23
Cloning
 Clone –
 _______ Scottish scientist Ian Wilmut cloned first mammal, Dolly the Sheep
14-3 Human Molecular Genetics
Human Genome Project
 Human Genome Project
 An international effort to completely map and sequence the human genome
 Started in _______ and completed in _______
 How did they do it?
24
 First determined markers –
 Cut DNA into random fragments
 Determined _______________ of the fragments
 Computers found areas of overlap between the fragments
 One surprise was how few genes humans have
 Fruit fly –
 Tiny worm –
 Human –
 A human diploid cell contains more than _______ billion base pairs
 Only about _______ of the DNA in your chromosomes functions as genes
 The average human gene consists of about _______ base pairs
 The largest gene in the human genome has more than _______ million base pairs
 Chromosome 22 and 21 were the first 2 human chromosomes sequenced
 Chromosome 22
 Contains approximately _______ million base pairs

 1 gene causes _______________
 1 gene causes _______________
 Chromosome 21
 Approximately _______ million base pairs

 Lou Gehrigs disease (ALS) –
25