Download Evaluation of the Y-Chromosome Structure

Diffusion: the UCLan Journal of Undergraduate Research Volume 1 Issue 1 (June 2008)
Evaluation of the Y-Chromosome Structure
Glenda Melling
1. The Structure of the Y-Chromosome
The Y chromosome is one of the smallest chromosomes within the human genome, with an
overall size of approximately 60Mb. Approximately 24Mb relate to the euchromatin region and
approximately 30Mb relate to the heterochromatin region, combined are referred to as the NRY
(non-recombining region) now renamed to MSY (male specific region), approximately 95% of
the Y chromosome (Butler 2003).
The Y-chromosome has become the most useful and informative haplotyping system with the
identification and characterisation of over 40 short tandem repeats, STRs and over 220 single
nucleotide polymorphisms, SNPs (Jobling et al. 2001).
Continual growth of reliable Short Tandem Repeat (STR) and Single Nucleotide Polymorphism
(SNP) markers provides the field of forensic science with a substantial tool for forensic DNA
profiling for cases involving paternity testing, missing persons, sexual assaults including mixed
stains, human migration and evolutionary studies and historical and genealogical research (Butler
2003).
The Y chromosome follows a purely paternal inheritance which approximately 99.99% is
inherited as complete from father to son through the ancestral generations. It remains entirely
unaltered and unaffected by influences or exchanges from the X chromosome of the mother
(Butler 2003).
This together with the fact that all of the genetic markers along the entire length of the Ychromosome are linked to one another, enables the construction of haplotypes from a
combination of different markers that can be used in
evolutionary history and human identification (Butler 2003).
1
studies of human migration, the
Diffusion: the UCLan Journal of Undergraduate Research Volume 1 Issue 1 (June 2008)
Figure 1.1
Schematic representation of the male specific region of the Y-chromosome
(Skaletsky et al. 2003)
a. Y-chromosome including the heterochromatic and pseudoautosomal regions.
b. Extended representation of a section of the MSY.
c. Densities of coding genes, transcriptional units and pseudogenes.
d. Nucleotide % within ALU, retroviral, LINE1 and total interspersed repeats.
2
Diffusion: the UCLan Journal of Undergraduate Research Volume 1 Issue 1 (June 2008)
1.2
Pseudoautosomal regions (PARs)
Pseudoautosomal regions (PAR) are the telomeric tips located at the distal part of the short arm
(Yp), referred to as PAR1, and is approximately 2.5Mb in length and at the distal part of the long
arm (Yq), referred to as PAR2, that is less than 1Mb in length (Skaletsky et al. 2003). Both are
homologous genes that recombine with the homologous genes of the X-chromosome during male
meiosis enabling crossing over to take place thereby allowing the genes to segregate like
autosomal loci (Butler 2003).
The gene MIC2 (major immunogene complex) that encodes for an integral membrane
glycoprotein CD99 is located on the short arm at Yp11.3 that undergoes crossing over with an
allele on the short arm of the X-chromosome at Xp22.23 (Skaletsky et al. 2003).
1.3
Heterochromatic region
The heterochromatic region as mentioned earlier is approximately 30Mb in length and located on
the distal long arm (Yq) of the Y chromosome (Skaletsky et al. 2003). It comprises of two major
highly repeated sequences DYZ1 and DYZ2 (Gusmão et al. 1999) and alphoid repeat sequences
that are clustered tandemly near to the Y-chromosome centromere that include the major SINE,
Alu repeat sequences important during spermatogenesis, and various families of satellite
sequences (Gusmão et al. 1999).
In addition the Y-chromosome consists of two DYZ1 repeat fragment lengths, one 2.1 Kb in
length and two types of Haemophilus aegyptius, HaeIII fragments, the Y-specific, YS and the
non-Y-specific, NSY (Gusmão et al. 1999) each 3.4Kb in length of which contain a satellite
predominantly comprising of a single array pentameric repeat 5‟TTCCA3‟ of which there are
approximately 800 to 4000 copies (Gusmão et al. 1999). The DYZ1 undergoes polar mutations
in both the 5‟ and 3‟ regions of the Y-chromosome and various hot spot mutations (Ali et al.
2003).
3
Diffusion: the UCLan Journal of Undergraduate Research Volume 1 Issue 1 (June 2008)
1.4
Male specific region (MSY) or non-recombining region (NRY)
Genomic studies undertaken by Skaletsky et al. (2003) provided evidence of an abundance of
intrachromosomal recombination resulting in what was known as the non-recombining region,
the NRY, being renamed to the male specific region, the MSY (Skaletsky et al. 2003).
The male specific region, the MSY, is the area of the Y-chromosome approximately 95% of the
total length that is predominantly responsible for male sex determination differentiating between
the male and female sexes. This region is divided equally by a mosaic of euchromatic regions,
consisting of functional genes and heterochromatic regions, areas lacking genes (Skaletsky et al.
2003).
The euchromatic region is subsequently sub-divided into three further classes referred to as the
X-Transposed Region, the X-Degenerative Region and the Ampliconic Region that contain 156
transcription units of which 78 are genes that encode for proteins and 27 genes that encode for
distant proteins (Skaletsky et al. 2003).
1.4.1 X-Transposed Region
X-transposed region occurs in two sequence blocks on the short arm Yp and combined are
approximately 3.4Mb in length and account for approximately 15% of the total MSY
euchromatin (Skaletsky et al. 2003). The sequences comprised within this region are 99%
identical to the sequences on the long arm of the X chromosome, of which there are two coding
genes each with X chromosome homologs at Yq21 (Skaletsky et al. 2003).
They exhibit the lowest gene density and the highest interspersed repeat density, of which 36%
represent long interspersed nuclear element 1 (LINE1), within the three classes of the MSY
euchromatin and are characteristic of the homologous sequence on the X-chromosome at Xq21
(Skaletsky et al. 2003).
These X-transposed sequences can be distinguished from the pseudoautosomal sequences at the
telomeric tips of the X and Y chromosomes, as they do not participate in X-Y crossing over
during male meiosis (Skaletsky et al. 2003).
4
Diffusion: the UCLan Journal of Undergraduate Research Volume 1 Issue 1 (June 2008)
1.4.2 X-Degenerative Region
X-degenerative region occurs in eight sequence blocks on both short arm Yp and the long arm
Yq and combined are approximately 8.6Mb in length and account for 20% of the total MSY
euchromatin (Skaletsky et al. 2003).
Comprised within this region are 27 different X-linked single copy genes, 13 of which are nonfunctional pseudogenes that contain similar sequences to that of the introns and exons of the X
homologue (Skaletsky et al. 2003).
Of the remaining 14, two Y-linked genes RPS4Y1 and RPS4Y2, homologues of the X-linked
gene RPS4X encode for two non-identical isoforms of the ribosomal protein S4 (families of
functionally related proteins that slightly differ in amino acid sequence), two Y-linked genes
CYorfl15A and CYorfl15B, homologues of the X-linked gene CXorfl15 encode for the aminoand carboxy-terminal regions of the CXorf15 protein and one relates to the functional gene SRY,
the sex determining region and 12 that encode for non-identical protein isoforms, (families of
functionally related proteins that slightly differ in amino acid sequences) (Skaletsky et al. 2003).
1.4.3 Ampliconic Region
Ampliconic region occurs in seven large sequence blocks on both the short arm Yp and the long
arm Yq and combined are approximately 10.2Mb in length accounting for 30% of the total MSY
euchromatin (Skaletsky et al. 2003).
The Ampliconic sequences exhibit the lowest gene density of LINE1 and interspersed repeat
elements and the highest coding and non-coding gene densities of the three classes of the MSY
euchromatin (Skaletsky et al. 2003).
The majority of the genes of which nine MSY specific protein coding gene families have been
identified (see figure), VCY, XKRY, HSFY, PRY all of which two copies exist, BPY2 of which
three copies exist, CDY, DAZ of which four copies exist and RBMY of which six copies exist,
5
Diffusion: the UCLan Journal of Undergraduate Research Volume 1 Issue 1 (June 2008)
(figure 1.4.4) are expressed exclusively in the testes encode for proteins that are specific for the
development, function and fertility of the testes in males (Skaletsky et al. 2003).
Figure 1.4.4 Protein coding genes on the MSY region with homologs on the X-chromosome
and genes not found on the X-chromosome (Skaletsky et al. 2003).
1.5
Palindromic DNA sequences
Comprised within the ampliconic region of the long arm (Yq) are eight long massive
palindromes designated P1 – P8 with arm lengths that range from 9Kb to 1.45KB in length. The
arms of the palindromes are highly symmetrical and exhibit 99.97% intra-palindromic, arm to
arm sequence identity (S. Rozen et al. 2003). Each set of the paired arms of the palindrome is
separated by a unique non-identical spacer that ranges in length from 2Kb to 170Kb (S. Rozen et
al. 2003).
6
Diffusion: the UCLan Journal of Undergraduate Research Volume 1 Issue 1 (June 2008)
The largest palindrome, P1, is 2.9Mb in length and bears within its arms two secondary
palindromes P1.1 and P1.2 each 24Kb in length. When totally combined the overall length of the
eight palindromes is approximately 5.7Mb that equates to about 25% of the total MSY
euchromatin (Skaletsky et al. 2003).
On the opposite arms of the palindrome identical or near identical copies of the genes expressed
on the MSY palindromes exist (Skaletsky et al. 2003).
Eight of the nine MSY specific protein coding gene families exhibit members on the
palindromes, six of which are exclusive to the palindrome those being the Deleted in
Azoospermia, the DAZ genes of which four copies exist, two in P1 and two in P2 exclusively,
and the Chromodomain, the CDY genes again of which four exist, two in P1 and two in P5 (S.
Repping et al. 2002).
Of the 15 genes and transcript families that have been identified in the arms of the palindromes,
non of which have been identified in the spacers, seven transcript families are non-coding
transcriptional units and six of the eight palindromes comprise of protein-coding genes, all of
which are specifically and exclusively expressed to the testes (S. Rozen et al. 2003).
1.6
Sex determining region (SRY)
Located within the euchromatic region of the MSY, adjacent to the pseudoautosomal region of
the short arm at band Yp11.3 is the critical gene identified by Sinclair et al. (1990) known as the
sex determining region, the SRY that specifically controls male sexual development by encoding
for the gene product the testis determining factor, TDF, which promotes the undifferentiated
gonadal tissue of the embryo to form the male testes (Sinclair et al. 1990).
The SRY containing 223 codons is encoded by a single exon (Behlke et al. 1993) and itself
encodes a transcription factor that is part of the DNA binding proteins known as the high
mobility group, HMG that regulate the transcription of genes responsible for differentiation of
the sexes.
7
Diffusion: the UCLan Journal of Undergraduate Research Volume 1 Issue 1 (June 2008)
1.7
Amelogenin
The AMELY (Amelogenin) gene on the Y-chromosome and the homologous AMELX gene on
the X-chromosome, both of which are functionally unique, have considerable influencing factors
in tooth bud growth by the promotion of amelogenesis which is involved in enamel growth and
dentinogenesis which is involved in dentine growth during human development (Butler 2005).
Sex determination is not only a useful tool but of extreme necessity in forensic investigations
specifically in cases of sexual assault, aged blood stains and human skeletal remains whereby
rapid, sensitive, accurate and reliable methods of investigation are of the utmost importance
(Butler 2005).
2. Length Polymorphisms on the Y-chromosome
2.1
Multi-allelic markers
Length polymorphisms include Y-STRs or microsatellites of which to date there are
approximately 220 markers that have been identified on the Y-chromosome and that are
potentially useful in the applications of forensic genetics (Gusmão et al. 2006).
Each Y-STR comprises of short sequences generally between 2 – 5 nucleotides in length, such as
DYS393 with a repeat motif AGAT and DYS438 with a repeat motif TTTTC for example, and
minisatellites of which there are two (Kayser et al. 2004) that comprise of longer sequences
generally between 10 - 60 base pairs in length, for example
CACAATATACATGATGTATATTATA (Type 1), both of which repeat many times over in
tandem (Gusmão et al. 2005).
Occasionally changes will occur within these sequences resulting in either an increase or
decrease in the number of repeats located at any specific allele indicating that changes may have
occurred many times through the generations along the paternal lineage (Gusmão et al. 2005).
Due to high mutation rates averaging 6-11% per generation for minisatellites loci and ~0.2% per
generation for Y-STRs (Dupuy et al. 2004), multi-allelic markers have proved to be extremely
8
Diffusion: the UCLan Journal of Undergraduate Research Volume 1 Issue 1 (June 2008)
useful in differentiating Y-chromosome haplotypes resulting in fairly high resolutions (Butler,
2003). Thus the mutation rates for SNPs are extremely low in contrast primarily due to different
mutational mechanisms hence the mutational rates for STRs are a bit higher (Dupuy et al. 1999).
In human population genetics the hypervariable Y-specific maker DYS19 is the most extensively
analysed STR, characterized currently by ten alleles from 174bp to 210bp in length and
consisting of a tetranucleotide tandem repeat motif GATA that is located on the short arm Yp of
the Y-chromosome (Quintana-Murch et al. 1999).
The largest proportion of the Y-STR loci is found within the long arm of the Y-chromosome of
which 25.3% at Yq11.221, 16.6% at Yq11.222 and 18.4% at Yq11.223 (Hanson et al. 2006).
Within the short arm of the Y-chromosome 22.1% are found at Yp11.2 and located within the
centromeric segment are three loci, DYS716 and DYS707 at Yp11.1 and DYS631 at Yq11.1
(Hanson et al. 2006). The sizes for all the STR loci repeat units have been identified and are
shown in figure 2.1.1 (Hanson et al. 2006).
Some of the advantages of using Y-STR markers as opposed to autosomal markers include; rapid
exclusion and inclusions of male suspects, possible analysis of azoospermic semen from
vasectomised males, due to the hemizygous nature of the Y-STR the number of male donors can
be determined in cases of gang rapes, in cases of sexual assault a male profile can readily be
obtained from overwhelmingly high quantities of female DNA, paternity testing and male
lineage studies, (Shewale et al. 2004).
Limitations of the Y-STR are few in comparison, the multiple locus frequency cannot be
established due to the specific loci being analysed on the Y-chromosome will be passed on
without recombination to the next generation and also Y-STRs have a lower power of
discrimination whereby non-exclusion cases, where male relatives of a suspect could not be
excluded, would require further analysis using autosomal STRs (Shewale et al. 2004).
9
Diffusion: the UCLan Journal of Undergraduate Research Volume 1 Issue 1 (June 2008)
Figure 2.1.1 The repeat structure sizes in bp of all the Y-STR loci of which is represented by
6% dinucleotide repeats, 39% trinucleotide repeats, 45% tetranucleotide repeats, 9%
pentanucleotides repeats and 1% hexanucleotide repeats (Hanson et al. 2006).
10
Diffusion: the UCLan Journal of Undergraduate Research Volume 1 Issue 1 (June 2008)
2.2
Bi-allelic markers, Y-SNPs
Biallelic markers are the most abundant of polymorphisms that include large numbers of SNPs
and the ALU insertion YAP-DYS287 (Underhill et al. 1996). SNPs are single nucleotide
polymorphisms whereby a specific nucleotide undergoes a change in the base-pair through
substitution, transition or transversion. To date approximately 250 Y-chromosome bi-allelic
markers have been characterized into haplogroups (Y Chromosome Consortium 2002).
The MSY1 minisatellite which is the most variable biallelic Y-specific marker contains a 25 AT
rich repeat sequence of which between 48 to 114 copies and a minimum of seven base
substitution variant repeat sequences (Jobling et al. 1998). The MSY1 is highly polymorphic and
an exceptionally high structural variation observed using the MVR-PCR strategy with a virtual
heterozygosity of 99.9% (Gusmão et al. 1999). With high mutation rates and the difficulties
encountered in the typing of degraded samples, it still provides and excellent informative source
of investigation for population studies (Gusmão et al. 1999).
The MSY2 (DYS440) the longest minisatellite contains a 99bp to 110bp repeat sequence, the
99bp sequence has a 45% GC content, with an array size of 3 to 4 units that lies less than 1Kb
from the DBY gene (Lahn and Page et al. 1997) and shows sufficiently low mutation rates and
detectable levels of variation in many lineages (Bao et al. 2000). The units each contain a short
palindromic repeat sequence CCTAGG and duplicated in most to CCTAGGCCTAGG (Bao et
al. 2000).
SNPs have proved to be potentially useful in the construction of haplogroups for investigations
in population and evolutionary studies; however it is imperative that the most appropriate SNPs
are meticulously selected for the purposes of forensic genetics since different SNPs can possibly
define the same haplogroup (Sanchez et al. 2004).
Two commonly used highly polymorphic SNPs of potential interest are Y-chromosome specific
loci P25 and 92R7 widely used in European population studies, of which both represent
significant branching points on the haplogroup tree have recently been studied by Sanchez et al.
(2004).
11
Diffusion: the UCLan Journal of Undergraduate Research Volume 1 Issue 1 (June 2008)
The study demonstrated that they are not in fact unique as originally thought, but are paralogous
sequence variants, PSVs that have originated from segmental duplications with a minimum of
one of the variants being polymorphic within each group of loci (Sanchez et al. 2004).
Results from the study showed that the ancestral allele C at loci P25 occurred in numerous
samples from different haplogroups and was always associated with an A variant at the 92R7
locus due to duplication, clearly this illustrates the relative importance of selecting unique loci
for studies in populations and forensic genetics (Sanchez et al. 2004).
A more recent population study by Adams et al. (2005) of the binary marker P25 of which three
copies of the sequence are located within the palindromic repeats of the long arm (Yq) of the Ychromosome and a single copy that has undergone a transversion of the C allele to an A allele by
gene conversion was undertaken to demonstrate that recurrent back-mutation can occur through
gene conversion (Adams et al. 2005, Rozen et al. 2003).
The study demonstrated that the binary marker P25 did in fact carry back- mutations as a result
of a minimum of two independent events of gene conversion from C/C/A to C/C/C and C/C/A to
C/A/A on the long arm (Yq) of the Y-chromosome within the palindromic repeats (Adams et al.
2005, Rozen et al. 2003). Phylogenic analysis of two Western European populations
demonstrated that these unusual gene conversions have occurred at least twice and should be
considered and accounted for in forensic investigations and population studies (Adams et al.
2005, Rozen et al. 2003).
2.3
Alu Polymorphisms
Variations in allele length are created by mutations via insertions into or deletions of generally
one nucleotide (1bp) of the DNA at specific loci on the Y-chromosome. A current insertion that
has proved to be exceptionally useful specifically in studies of haplotype groups within
populations is the Y Alu polymorphism (YAP), the first Y-chromosome bi-allelic marker to be
discovered (Hammer et al. 1994).
12
Diffusion: the UCLan Journal of Undergraduate Research Volume 1 Issue 1 (June 2008)
Alu sequences generally consist of approximately 300bp of which half a million copies exist
have been inserted into specific regions on the Y-chromosome (Hammer et al. 1994). One of the
most commonly used and more stable Y Alu polymorphisms is the DYS287 indicated by the
presence or absence of a 303bp Alu element on the long arm, Yq, of the Y-chromosome
(Quintana-Murch et al. 1999).
2.4
Unique and recurrent event polymorphisms
Classification of the Y-chromosome markers based on their mutation rates is used to distinguish
between unique and recurrent event polymorphisms (Hurles and Jobling, 2001).
Stable Alu‟s, SNPs and indels (insertions / deletions) that have low mutation rates and the
multiallelic markers such as minisatellites and microsatellites that have higher mutation rates are
referred to as “unique event polymorphisms” or “UEPs” of which to date there are in excess of
200 available (Hurles and Jobling, 2001).
UEPs are rare, infrequent and quite often relatively population specific and are assumed to have
only occurred once during the course of human evolution at any specific loci within the genome
as a result of reduced Y-chromosome diversity through natural selection (Hurles and Jobling,
2001).
Haplogroups which are binary polymorphisms of unique origin that have been combined into
monophyletic compound haplotypes (a natural taxon of known or hypothesized ancestral
individuals / population haplotypes including all of its descendants), that are phylogenetically
related to one another by a single most parsimonious tree (Figure 2.4.1) (Hurles and Jobling,
2001).
Comparisons made between human sequence diversity and between humans and apes, „using
estimates of the date of the human-ape divergence‟ started by Hurles and Jobling (2001),
estimated the time of the most recent common ancestor of currently existing Y-chromosome
UEPs to be between 50,000 and 200,000 years ago (Hurles and Jobling 2001).
13
Diffusion: the UCLan Journal of Undergraduate Research Volume 1 Issue 1 (June 2008)
Recurrent event polymorphisms consist of highly polymorphic markers that have high levels of
diversity such as tandem arrays and microsatellites that have a repeat unit length of between 1bp
to 6bp and an allele length that is highly variable, also included is a single hypervariable
minisatellite (Jobling et al. 1988a), all of which will occur in all populations (Hurles and Jobling
2001).
Unlike UEPs, recurrent event polymorphisms cannot be used in the construction of a single most
parsimonious tree due to the slowly mutating polymorphisms retaining some phylogenetic data
and their monophyletic compound haplotypes baring some statistical information with the tree of
haplogroups (Hurles and Jobling 2001).
14
Diffusion: the UCLan Journal of Undergraduate Research Volume 1 Issue 1 (June 2008)
15
Diffusion: the UCLan Journal of Undergraduate Research Volume 1 Issue 1 (June 2008)
Figure 2.4.1. A single most parsimonious tree constructed from 153 haplogroups (The YChromosome Consortium, 2002).
16
Diffusion: the UCLan Journal of Undergraduate Research Volume 1 Issue 1 (June 2008)
Figure 2.5.1 A diagram showing the functional map of the Y-chromosome identifying the X-homologous genes, the SRY region, the
MSY region referred to as the Non-combining region and the AZFa, AZFb and AZFc regions that are located within the DAZ genes
(Lahn and Page, 1997).
17
Diffusion: the UCLan Journal of Undergraduate Research Volume 1 Issue 1 (June 2008)
3.
Forensic Applications
3.1
Sexual assault.
Y-specific polymorphisms, predominantly STRs have proved to be an exceptionally
useful discriminating tool in forensic investigations in the detection of the male DNA
fraction and with the generation of genetic profiles obtained from mixed body fluid stains
recovered from sexual assault cases where male suspects are involved including those
that are azoospermic, such as male / female sexual assaults, male / male sexual assaults
and in the determination of the number of male donors associated with gang rapes
(Hanson et al. 2006).
3.2
Paternity testing
The pattern of inheritance along male linage makes the Y-STR polymorphisms suitable
for paternity testing when a male offspring is in question, or in deficiency cases
particularly when the father is alleged to be deceased, it is possible to gain access to his
complete Y-chromosome information by using DNA from any male relative in
patrilineage. A result based exclusively in the Y-chromosome STRs does not exclude as
the father any male relative in the same patrilineage (Gusmão et al. 1999).
An important aspect in paternity testing and forensic analysis is the accurate
interpretation of genetic profiles taking in to account the likelihood % rates of potential
STR mutations that could significantly effect the exclusion or inclusion of biological
paternity of a putative father (Kayser et al. 2001).
Current criteria for paternity testing indicates that one or two differences between 6 – 15
STR loci are considered to be as a result of mutations and exclusion of paternity, however
a recent study of 415 father / son pairs of confirmed paternity displayed evidence of three
differences as a result of rare multiple STR mutations within a single germline that could
only be identified when the number of analysed STR loci was increased from nine to
fifteen evidently providing higher levels of discrimination (Kayser et al. 2001).
18
Diffusion: the UCLan Journal of Undergraduate Research Volume 1 Issue 1 (June 2008)
As a result of this and previous investigations recommendations have been made to the
International Society of Forensic Genetics, the ISFG to redefine the paternity testing
criteria to encompass that exclusion of paternity should be based on the possibility of
mutations occurring at three STR loci when a minimum of nine STR loci are analysed
(Kayser et al. 2001).
3.3
Inference of Geographical Origin, historical and genealogical research
Population surveys based on haplotypes including biallelic, STR loci and the minisatellite
MSY1 seem to be the best strategy for use in population genetic and evolutionary studies.
Trees based in median network strategies using haplotypes including all these markers
allow a better analysis of populations as well as greater information in evolutionary
studies (Gusmão et al. 1999).
New opportunities have arisen due to the identification of many hundreds of valuable and
reliable PCR compatible binary Y polymorphisms providing new areas for analysis of
male specific DNA within a wide diversity of populations and sub-populations that may
provide evidence of biogeographical ancestry (Underhill et al. 2001, Ali et al. 2003).
Y-SNPs due to the absence of recombination, extremely low mutation rates and paternal
heritage represent a valuable tool that is relatively suitable for the identification of stable
paternal lineages and the exploration of human evolution (Onofri et al. 2005). A series of
six hierarchal multiplexes (Figure 3.3.1) have been developed by Onofri et al. (2005)
which are located in the basal and shallowest branches of the phylogenetic tree to explore
the major clades A-R and subclades enabling discrimination of haplogroups that belong
to specific continents (Onofri et al. 2005).
19
Diffusion: the UCLan Journal of Undergraduate Research Volume 1 Issue 1 (June 2008)
Figure 3.3.1 Electropherograms and cladograms of the six hierarchal Y-SNP
multiplexes (Onofri et al. 2005)
4.
Discussion
Perusal of various peer reviewed journals and associated literature have provided an
overall understanding of a selection of genes on the Y-chromosome and subsequential
effects of specific characterised Y-linked and autosomal gene mutations.
20
Diffusion: the UCLan Journal of Undergraduate Research Volume 1 Issue 1 (June 2008)
Forensic investigations involving samples of mixed body fluids from male and female
donors can be rapidly and reliably analysed with sufficient sensitivity to produce a
complete profile using < 0.5 ng of male DNA and < 400ng of female DNA for the 11 YSTR loci, DYS19, DYS39I, DYS389II, DYS390, DYS391, DYS392, DYS393,
DYS385a/b, DYS438, DYS439 and the amelogenin locus as recommended by the
Scientific Working Group on DNA Analysis Methods, SWGDAM providing conclusive
and valid results (Shewale et al. 2004).
The Y-chromosome now plays an important valuable role and is being increasingly
utilised in forensic investigations including paternity cases, sexual assault cases, and
evolution of human populations along the paternal line due to the vast variety of
variations such as STRs characterised by their high mutational rates and Alus
characterised by mutational changes occurring only once in human evolution.
Y-STR haplotypes represent information from the non-coding lineage of the Ychromosome that is shared with many male individuals along the paternal line. Unlike
autosomal STR markers the Y-STR haplotypes do not provide indivualisation, however
Y-STRs have proved more beneficial and conclusive in deficiency paternity cases of
male offspring where autosomal STRs have failed (Gusmão et al. 2005).
To date 417 Y-STR loci have been sequentially positioned and their positions determined
relative to their structural genes along the Y-chromosome that are available for all types
of forensic investigations, however due to the high degree of homology with the Xchromosome and low genetic variance, a vast number of the Y-STR markers may be
deemed unsuitable for forensic use (Hanson et al. 2006).
Taking this into account the ever increasing development in Multiplex Y-STR systems
offers substantial and valuable information in forensic genetics ensuring the exclusion of
redundant loci and will provide high resolution linkage relationships of the Y-STR loci in
order to distinguish between DNA mixtures and chromosomal rearrangements such as
deletions and inversions (Hanson et al. 2006).
21
Diffusion: the UCLan Journal of Undergraduate Research Volume 1 Issue 1 (June 2008)
Binary polymorphisms, specifically SNPs are widely used in population studies defining
haplogroups that “show a high degree of geographical specificity making them
potentially useful in prediction of population of origin of a DNA sample” (Jobling et al.
2001).
Low mutation rates of the binary polymorphisms and SNPs, of which there are only 6 out
of 240 SNPS that show evidence of recurrent mutations (Adams et al. 2005, Skaletsky et
al. 2003), provide stability of the haplogroups allowing arrangement of such groups to be
used in the construction of a unique maximum parsimony tree (Jobling et al. 2001).
Within the Y-chromosome between 30 – 45% of the genes display a paralogous sequence
or high sequence similarity a point that should be seriously considered and taken into
account when used in population studies and forensic investigations (Adams et al. 2005,
Skaletsky et al. 2003).
From all the studies investigated and the ongoing studies and development work of the Ychromosome and representative length polymorphisms it has and will continue to be a
highly beneficial and valuable asset alongside autosomal STRs within the field of
forensic genetics and more so in genealogical origins, ancestry and population studies.
References
Adams, S et al. 2005. „The case of the unreliable SNP: Recurrent back-mutation of Ychromosomal marker P25 through gene conversion‟, Forensic Science International 159,
14-20.
Ali, S and Hasnain, S.E. 2003. „Genomics of the human Y-chromosome 1. Association
with male infertility‟, Gene 321, 25-37.
Bao, W et al. 2000. „MSY2: a slowly evolving minisatellite on the human chromosome
which provides a useful polymorphic marker in Chinese populations, Gene 244, 29-33.
Behlke, M.A et al. 2003. „Evidence that the SRY protein is encoded by a single exon on
the human Y-chromosome‟, Genomics 17, 736-739.
22
Diffusion: the UCLan Journal of Undergraduate Research Volume 1 Issue 1 (June 2008)
Butler, J.M. 2003. „Recent developments in Y-short tandem repeat and Y-single
nucleotide polymorphism analysis‟, Forensic Science Review 15-2.
Butler, J.M et al. 2005. „Chromosomal Duplications Along the Y-Chromosome and Their
Potential Impact on Y-STR Interpretation‟, Journal of Forensic Science 50.
Dupuy, B.M et al. 2004. „Y-chromosomal microsatellite mutation rates: differences in
mutation rates between and within loci‟, Human Mutation 23, 117-124.
Gusmão, L et al. 1999. „Y-chromosome specific polymorphisms in forensic analysis‟,
Legal Medicine 1, 55-60.
Gusmão, L et al. 2005. „Mutation rates at Y-chromosome microsatellites‟, Human
Mutation 26, 520-528.
Gusmão, L et al. 2006. „DNA Commission of the International Society of Forensic
Genetics (ISFG): An update of the recommendations on the use of Y-STRs in forensic
analysis‟, Forensic Science International 157, 187-197.
Hammer, M.F. 1994. „A recent insertion of an Alu element on the Y-chromosome is a
useful marker for human population studies‟, Molecular Biology Evolution 11, 749-761.
Hammer, M.F et al. 1997. „The geographic distribution of human Y-chromosome
variation‟, Genetics 145, 787-805.
Hanson, E.K and Ballantyne, J. 2006. „Comprehensive annotated STR physical map of
the human Y-chromosome: Forensic implications‟, Legal Medicine 8, 110-120.
Hurles, M.E and Jobling, M.A. 2001. „Haploid chromosomes in molecular ecology:
lessons from the human Y‟, Molecular Ecology 10, 1599-1613.
Jobling, M.A, Bouzekri, N and Taylor, P.G. 1998, 1998a. „Hypervariable digital DNA
codes for human paternal lineages: MVR-PCR at the Y-specific minisatellite, MSY1
(DYF155S1)‟, Human Molecular Genetics 7, 643-653.
Jobling, M.A and Tyler-Smith, C. 2001. „Y-chromosomal SNP haplotype diversity in
forensic analysis‟, Forensic Science International 118, 158-162.
Kayser, M and Sajantila, A. 2003. „Mutations at Y-STR loci: implications for paternity
testing and forensic analysis‟, Forensic Science International 118, 116-121.
Kayser, M et al. 2003. „Y chromosome STR haplotypes and the generic structure of U.S.
populations of African, European and Hispanic ancestry‟, Genome Research 13, 624-634.
Lahn, B.T. and Page, D.C, 1997. „Functional coherence of the human Y-chromosome‟,
Science 278, 675-680.
23
Diffusion: the UCLan Journal of Undergraduate Research Volume 1 Issue 1 (June 2008)
Onofri, V et al. 2006. „Development of multiplex PCRs for evolutionary and forensic
applications of 37 human Y chromosome SNPs‟, Forensic Science International 157, 2325.
Quintana-Murci, L et al. 1999. „Y-chromosome specific YCAII, DYS19 and YAP
polymorphisms in human populations: a comparative study‟, Annual Human Genetics 63,
153-166.
Roewer, L. 2003. „The use of the Y chromosome in forensic genetics – current practices
and future perspectives‟, International Congress Series 1239, 279-280.
Rozen, S et al. 2003. „Abundant gene conversion between arms of palindromes in human
and ape Y-chromosomes‟, Nature 423, 873-876.
Sanchez, J.J et al. 2004. „Duplications of the Y-chromosome specific loci P25 and 92R7
and forensic implications‟, Forensic Science International 140, 241-250.
Shewale, J.G et al. 2004. „Y-Chromosome STR System, Y-PLEX™ 12, for Forensic
Casework: Development and Validation‟, Journal of Forensic Science 49.
Sinclair, A.H et al. 1990. „A gene from the human sex-determining region encodes a
protein with homology to a conserved DNA-binding motif‟, Nature 346, 240-244.
Skaletsky, H et al. 2003. „The male specific region of the Y chromosome is a mosaic of
discrete sequence classes‟, Nature 423, 825-837.
Underhill, P.A et al. 1996. „Detection of numerous Y-chromosome biallelic
polymorphisms by denaturing high-performance liquid chromatography‟, Genome
Research 7 996-1005.
Underhill, P.A et al. 2001. „The phylogeography of Y-chromosome binary haplotypes
and the origin of modern human populations‟, Annual Human Genetics 65, 43-62.
Y Chromosome Consortium. 2002. „A nomenclature system for the tree of human Ychromosomal binary haplogroups‟, Genome Research 12, 339-348.
24