Download A series of promoters for constitutive expression of heterologous

Yeast
Yeast 2008; 25: 371–376.
Published online in Wiley InterScience
(www.interscience.wiley.com) DOI: 10.1002/yea.1593
Yeast Functional Analysis Report
A series of promoters for constitutive
expression of heterologous genes in fission
yeast
Akihisa Matsuyama*, Atsuko Shirai and Minoru Yoshida
Chemical Genetics Laboratory, RIKEN, Saitama 351-0198, CREST, JST, Saitama 332-0012, Japan
*Correspondence to:
Akihisa Matsuyama, Chemical
Genetics Laboratory, RIKEN,
Saitama 351-0198, Japan.
E-mail: [email protected]
Received: 15 October 2007
Accepted: 12 March 2008
Abstract
Inducible/repressible promoters are useful for the maintenance of toxic genes or
timely expression. For ectopic expression of cloned genes in the fission yeast
Schizosaccharomyces pombe, the thiamine-regulatable nmt1 promoter has been widely
used, since the transcriptional activity of this promoter can be controlled by
thiamine. However, this property sometimes limits a certain type of research, since
the expression inevitably requires cells to be cultivated under the conditions that
induce promoter activation. To allow constitutive expression of heterologous genes,
we cloned three promoters of cam1+ , tif51+ and ef1a-c + . Construction of a series
of vectors comprising these promoters and their introduction into the fission yeast
cells demonstrated that the activity was different among these promoters but was not
affected by cultured media commonly used in fission yeast. Therefore, a promoter
with appropriate strength would be selectable from these promoters, depending on
the genes to be expressed. Copyright  2008 John Wiley & Sons, Ltd.
Keywords: Schizosaccharomyces pombe; vector; plasmid; cloning; chromosomal
integration
Introduction
Expression of a cloned gene of interest is one
of the most standard and useful ways to investigate the function of the gene. Although several
promoters, including mammalian viral promoters,
have been reported in fission yeast, Schizosaccharomyces pombe, as described by Siam et al. (2004)
and references therein, the nmt1 promoter that is
repressible by addition of thiamine into a medium
has been most widely used for expressing heterologous genes (Maundrell, 1990). To induce varying levels of expression of the genes, two versions of the nmt1 promoter have been additively
employed (denoted as nmt1 ∗ and nmt1 ∗∗ , which
show medium and low transcriptional activities,
respectively; Basi et al., 1993). The transcriptional
activity of each version can also be varied depending upon the absence and presence of thiamine in
Copyright  2008 John Wiley & Sons, Ltd.
the medium. Furthermore, temperature-dependent
induction activity of the truncated derivative of the
nmt1 promoter was also reported recently (Kumar
and Singh, 2006). In addition to the nmt1 promoter,
several promoters that are also used for induced
expression of heterologous genes have been developed (Bellemare et al., 2001; Erler et al., 2006;
Fujita et al., 2006; Iacovoni et al., 1999). These
types of inducible promoters are very useful for
the maintenance of cloned genes that have harmful effects on cell growth, and timely expression
to investigate the function of the gene in a specific
situation. In particular, they are indispensable for
the construction of expression libraries, especially
cDNA libraries, since virtually all of them contain
several harmful genes. Despite their usefulness,
however, it may be a drawback that these promoters
should be stimulated under the specific conditions
that allow their activation. The nmt1 promoter, for
372
example, is not suitable for overexpression of genes
in YE medium containing intrinsic thiamine, which
is commonly used for yeast cell culture. Therefore,
this property of the nmt1 promoter may limit the
area of research in some cases.
In addition to these inducible promoters, the
adh1 promoter has been used in a number of
expression vectors, and its transcription level was
compared with that of the nmt1 promoter in
some experiments (reviewed by Siam et al., 2004)).
Although its expression is thought to be constitutive, it is not fully known how much its transcriptional activity varies among different media.
Furthermore, it has been reported that several viral
promoters can function, and therefore can be used
for heterologous gene expression in fission yeast
(Gmunder and Kohli, 1989; Jones et al., 1988;
Toyama et al., 1992; Toyama and Okayama, 1990).
However, it is less known whether or not they are
constitutive in any medium used in fission yeast.
In this paper, we report on three novel promoters that can be used for constitutive expression
of cloned genes. We estimated the transcriptional
activity of each promoter in several media used
commonly in fission yeast. The different levels
of expression directed by these promoters would
allow selection of a promoter that has the suitable transcriptional activity for an individual experiment.
Materials and methods
Sz. pombe strains and media
Sz. pombe wild-type strains JY3 (h 90 prototroph)
and AM2 (h 90 leu1-32 ) were used in this study.
Complete medium (YE; 0.5% yeast extract, 2%
glucose, 5 µg/ml adenine), minimal medium (SD),
and minimal medium (MM) were used for the
culture of Sz. pombe cells (reviewed by Forsburg
and Rhind, 2006). Thiamine and leucine were
added to the media at a final concentration of 15 µM
and 50 µg/ml, respectively, when needed.
Genetic methods and transformation
of Sz. pombe
General methods to handle fission yeast cells were
as described (Forsburg and Rhind, 2006). Highefficiency transformation of Sz. pombe cells was
carried out as described previously (Matsuyama
Copyright  2008 John Wiley & Sons, Ltd.
A. Matsuyama et al.
et al., 2000). For chromosomal integration of a
series of pDUAL-based plasmids, each DNA was
digested with NotI in a volume of 10–20 µl,
and 3–4 µl of the resultant solution was directly
used for transformation of AM2 (Matsuyama et al.,
2004). Leu+ transformants were selected on an SD
plate lacking leucine.
Cloning of the promoters used in this study
For cloning of the promoters of cam1 + , tif 51+ and
ef 1a-c + , PCR primers were designed to amplify
about 700 bp of the promoter region of each gene.
Pyrobest DNA polymerase (TaKaRa Bio Inc.)
was used for amplification. Primers used for amplification of the promoters were as follows; SphIPcam1-F, AACCAGCTGCATGCGCTATAGCATACTACGTTG; NheI-Pcam1-R, AAGCTGACGCTAGCATCAGTAACTCTAAAGTCCTTC; SphIPtif51-F, AACCAGCTGCATGCAACCGGACTC
ATCTTTGTGAG; NheI-Ptif51-R, AAGCTGAC
GCTAGCTCTAAACGATTCTTAAACTTG; SphIP-EF1a-F, CCAGCTGCATGCATTTCAATCATT
TTAGGAGAC; and NheI-P-EF1a-R, GTCGACG
CTAGCGTGAGTTCGATGAAACAGACTC. The
5 - and the 3 -primers contain an SphI restriction site and an NheI site, respectively. The
resultant PCR products were digested with these
restriction endonucleases and inserted into the
same sites of the pDUAL-based plasmids, such as
pDUAL–FFH1 (Matsuyama et al., 2004), resulting
in the replacement of the pre-existing nmt1 promoter. Plasmids constructed in this study are listed
in Table 1. Nucleotide sequence data of these plasmids are available in the DDBJ/EMBL/GenBank
databases under Accession Nos AB364119–50.
Measurement of the protein levels
by fluorescent microscopy
The transcriptional activity of the promoters used
in this study was quantified by measuring the fluorescence intensity of GFP expressed under each
promoter. pDUAL–GFH1, −31, −41, −51, −61
and −81 (DDBJ/EMBL/GenBank Accession Nos
AB364055, AB364132, AB364056, AB364133,
AB364134 and AB364057, respectively) were integrated at the chromosomal leu1 locus of AM2.
The resultant integrants were cultured in YE, SD,
MM and MM containing 15 µM thiamine to midlog phase at 30 ◦ C. GFP fluorescence in living
cells was monitored by the Axiophot2 microscope
Yeast 2008; 25: 371–376.
DOI: 10.1002/yea
Fission yeast constitutive promoters
(Carl Zeiss) with an appropriate set of filters. GFP
fluorescence intensity of each integrant was determined by calculating the mean of fluorescence of
30 cells from three independent colonies. To minimize errors in measurement of the fluorescence
intensity, the samples were not exposed to the excitation light before data acquisition. Emission light
was incorporated for 3 s in every sample.
β-Galactosidase assay
β-Galactosidase activity was measured in a 96well plate format as described below. The lacZ
reporter gene was amplified by two-step PCR
from pMC1871 (GenBank Accession No. VB0127)
and subcloned as an entry clone using the Gateway system (Invitrogen). PCR primers used for
amplification of the lacZ ORF were as follows: LacZ-CF, AAAAAGCAGGCTCTCATATGGTCGTTTTACAACGTCGTGA; and LacZ-CR,
AGAAAGCTGGGTCTCGAGTGATTTTTGACACCAGACCAACT. After verification by sequencing, the lacZ ORF subcloned into pDONR221
(Invitrogen) was transferred to the Sz. pombe
expression vector pDUAL–FFH1c and its promoter derivatives via the LR reaction. The resultant expression plasmids were digested with NotI
and introduced into AM2. Each integrant was
cultured as in the case of the GFP reporter
assay. Cells were harvested in a 96-well plate
and resuspended in Y-PER Yeast Protein Extraction Solution (Pierce) containing o-nitrophenylβ-D-galactopyranoside (ONPG). The reaction was
stopped by the addition of 1 M sodium carbonate. After centrifugation, OD420 of the supernatants were measured using SpectraMax M2e
(Molecular Devices). β-Galactosidase activity was
expressed in Miller units: 1000 × OD420 /reaction
time (min)/culture density (OD600 )/volume of culture used for assay (ml).
Results and discussion
Cloning of promoters with different
transcriptional activity
To screen for the promoters suitable for expression of a cloned gene, we first estimated the relative amount of all gene transcripts by analysing
total RNAs prepared from the wild-type strain
grown in minimal medium MM, using a DNA
Copyright  2008 John Wiley & Sons, Ltd.
373
microarray (our unpublished experiments). Among
the promoters with a certain level of expression, we then selected several promoters that were
expected to show constitutive expression, irrespective of culture media, according to the previously reported microarray data (Chen et al., 2003;
Rustici et al., 2004). Considering the restriction
enzyme recognition sites together with these data,
we finally selected three promoters derived from
cam1 + (encoding calmodulin), tif 51+ (eIF5A),
and ef 1a-c + (EF-1α). Each promoter was amplified by PCR from the genomic DNA of a wild-type
strain and was inserted into a series of pDUALbased vectors (Matsuyama et al., 2004), thereby
replacing the pre-existing nmt1 promoter. Thus,
a new series of pDUAL vectors, which can be
used for chromosomal integration, were generated
(Table 1).
Measurement of the promoter activity
To examine the relative transcriptional activities of
these promoters, we used pDUAL–GFH1 (Matsuyama et al., 2004) and its promoter derivatives.
These plasmids can express the green fluorescent
protein (GFP) fused with the FLAG epitope and
a hexahistidine tag (His6 ). To measure them more
precisely, we made a set of strains in which plasmids were integrated at the chromosomal leu1
locus by using pDUAL-based vectors. We measured the expression levels of GFP when integrants are cultured in YE, SD and MM media
that are commonly used in fission yeast study.
In addition, we examined the effect of thiamine
on these promoters (Figure 1). Among the promoters tested, the nmt1 promoter had the preeminent activity in MM medium. In addition to the
wild-type nmt1 promoter, the weakened derivatives
of the nmt1 promoter (nmt1 ∗ and nmt1 ∗∗ ) were
repressed in other media. In contrast, other promoters showed constitutive transcriptional activity
in any medium, suggesting that these promoters
cannot be repressed by thiamine or by the substances contained in the media tested. The tif51
and the ef1a-c promoters showed similar transcriptional activity, although the ef1a-c promoter
activity seemed slightly stronger in any medium.
The cam1 promoters showed transcriptional activity comparable to the fully induced activity of the
nmt1 ∗ promoter.
Yeast 2008; 25: 371–376.
DOI: 10.1002/yea
374
A. Matsuyama et al.
Table 1. Vectors constructed in this study
Name
pDUAL–HFF31
pDUAL–HFF51
pDUAL–HFF61
pDUAL–HFG31
pDUAL–HFG51
pDUAL–HFG61
pDUAL–FFH31
pDUAL–FFH51
pDUAL–FFH61
pDUAL–GFH31
pDUAL–GFH51
pDUAL–GFH61
pDUAL–HFF31c
pDUAL–HFF51c
pDUAL–HFF61c
pDUAL–HFG31c
pDUAL–HFG51c
pDUAL–HFG61c
pDUAL–FFH31c
pDUAL–FFH51c
pDUAL–FFH61c
pDUAL–GFH31c
pDUAL–GFH51c
pDUAL–GFH61c
∗
Promoter
Tag
Tag position
ccdB∗
Accession No.
cam1
tif51
ef1a-c
cam1
tif51
ef1a-c
cam1
tif51
ef1a-c
cam1
tif51
ef1a-c
cam1
tif51
ef1a-c
cam1
tif51
ef1a-c
cam1
tif51
ef1a-c
cam1
tif51
ef1a-c
His6 –FLAG2
His6 –FLAG2
His6 –FLAG2
His6 –FLAG –GFP
His6 –FLAG –GFP
His6 –FLAG –GFP
FLAG2 –His6
FLAG2 –His6
FLAG2 –His6
GFP–FLAG–His6
GFP–FLAG–His6
GFP–FLAG–His6
His6 –FLAG2
His6 –FLAG2
His6 –FLAG2
His6 –FLAG –GFP
His6 –FLAG –GFP
His6 –FLAG –GFP
FLAG2 –His6
FLAG2 –His6
FLAG2 –His6
GFP–FLAG–His6
GFP–FLAG–His6
GFP–FLAG–His6
5
5
5
5
5
5
3
3
3
3
3
3
5
5
5
5
5
5
3
3
3
3
3
3
−
−
−
−
−
−
−
−
−
−
−
−
+
+
+
+
+
+
+
+
+
+
+
+
AB364120
AB364121
AB364122
AB364124
AB364125
AB364126
AB364128
AB364129
AB364130
AB364132
AB364133
AB364134
AB364136
AB364137
AB364138
AB364140
AB364141
AB364142
AB364144
AB364145
AB364146
AB364148
AB364149
AB364150
This cassette makes the vectors Gateway-compatible.
Figure 1. The activity of promoters in different media
as assessed by GFP fluorescence. The expression level
of GFP was calculated using fluorescent microscopy.
pDUAL–GFH integrants, in which GFP is expressed under
the promoter indicated, were cultured to mid-log phase in
the indicated media at 30 ◦ C. Values were calculated as the
mean of fluorescence of 30 cells from three independent
transformants. Error bars represent standard deviation (SD)
from the mean. nmt1∗ , medium-strength nmt1 promoter;
nmt1∗∗ , low-strength nmt1 promoter
To further confirm the transcriptional activity of
these promoters, we also estimated the expression
Copyright  2008 John Wiley & Sons, Ltd.
levels of lacZ using the set of promoters. The
lacZ reporter gene was fused to pDUAL–FFH1c
(Matsuyama et al., 2004) and its promoter derivatives. These plasmids were then integrated into the
leu1 locus of AM2, as was the case for GFP.
We carried out β-galactosidase assays using integrants grown in the media that were also used
to monitor the GFP expression. Although the signal range was different, a similar tendency was
observed as compared with the GFP reporter assay
(Figure 2). Whereas three versions of the nmt1 promoter showed a nearly 10- to 20-fold activation
in MM medium containing no thiamine, transcriptional activity of three promoters cloned in this
study were not largely altered in any medium. The
tif51 and the ef1a-c promoters showed similar transcriptional activities, which were slightly stronger
than the induced activity of the nmt1 ∗ promoter
in this assay. The cam1 promoter showed weaker
activity as compared with the tif51 and the ef1a-c
promoters. Some small differences in the relative
transcriptional activity were seen in two reporter
assays, especially in comparison of the activities
between the nmt1 promoter derivatives and the
promoters cloned in this study. For example, the
Yeast 2008; 25: 371–376.
DOI: 10.1002/yea
Fission yeast constitutive promoters
375
Therefore, the more promoters whose transcriptional activities are characterized when used for
heterologous gene expression are listed, the more
variety of analyses would be feasible. In this sense,
in addition to the previously reported promoters,
the promoters described herein would become a
useful option for functional analysis of genes, especially for those having no adverse effect on cells.
Acknowledgements
Figure 2. The promoter activity assessed by β-galactosidase
assay. Transcriptional activity of each promoter was
assessed by measuring β-galactosidase activity of pDUAL–
FFH integrants cultured as described in Figure 1. Values
were calculated using three independent transformants.
Error bars represent SD from the mean
nmt1 ∗ promoter showed relatively stronger activity
than measured using the GFP reporter. However,
these differences are probably mostly due to differences in the systems that were used to quantify
the transcriptional activity, as discussed previously
(Grünenfelder and Winzeler, 2002).
Conclusion
As shown in two reporter assays, since all the
promoters newly cloned were not affected by the
normal medium for cell culture, the use of them
enables us to constitutively express cloned genes.
By estimating their transcriptional activity using
GFP and lacZ as a reporter, we could divide them
into two classes: cam1 (low-level expression) and
tif51 and ef1a-c (high-level expression). A suitable
promoter for heterologous expression of a certain
gene of interest should be ideally determined for
each experiment. As reported previously, however,
since mRNA abundance of a transgene sometimes
has a poor correlation with protein abundance when
overexpressed under the control of a heterologous
promoter (Matsuyama et al., 2006), varying levels
of transcription by promoters with different activities does not always result in the desired protein
levels. These properties often make it difficult to
know how much level of transcriptional activity is
suitable for expression of a cloned gene of interest.
Copyright  2008 John Wiley & Sons, Ltd.
This work was supported in part by the CREST Research
Project, Japan Science and Technology Agency. A.M. was
supported in part by Grant-in-Aid for Young Scientists
(A) from the Ministry of Education, Culture, Sports, Science and Technology of Japan.
References
Basi G, Schmid E, Maundrell K. 1993. TATA box mutations in the
Schizosaccharomyces pombe nmt1 promoter affect transcription
efficiency but not the transcription start point or thiamine
repressibility. Gene 123: 131–136.
Bellemare DR, Sanschagrin M, Beaudoin J, Labbe S. 2001. A
novel copper-regulated promoter system for expression of
heterologous proteins in Schizosaccharomyces pombe. Gene
273: 191–198.
Chen D, Toone WM, Mata J, et al. 2003. Global transcriptional
responses of fission yeast to environmental stress. Mol Biol Cell
14: 214–229.
Erler A, Maresca M, Fu J, Stewart AF. 2006. Recombineering
reagents for improved inducible expression and selection marker
re-use in Schizosaccharomyces pombe. Yeast 23: 813–823.
Forsburg SL, Rhind N. 2006. Basic methods for fission yeast. Yeast
23: 173–183.
Fujita Y, Tohda H, Giga-Hama Y, Takegawa K. 2006. Heat shockinducible expression vectors for use in Schizosaccharomyces
pombe. FEMS Yeast Res 6: 883–887.
Gmunder H, Kohli J. 1989. Cauliflower mosaic virus promoters
direct efficient expression of a bacterial G418 resistance gene in
Schizosaccharomyces pombe. Mol Gen Genet 220: 95–101.
Grünenfelder B, Winzeler EA. 2002. Treasures and traps in
genome-wide data sets: case examples from yeast. Nat Rev
Genet 3: 653–661.
Iacovoni JS, Russell P, Gaits F. 1999. A new inducible protein
expression system in fission yeast based on the glucoserepressed inv1 promoter. Gene 232: 53–58.
Jones RH, Moreno S, Nurse P, Jones NC. 1988. Expression
of the SV40 promoter in fission yeast: identification and
characterization of an AP-1-like factor. Cell 53: 659–667.
Kumar R, Singh J. 2006. A truncated derivative of nmt1 promoter
exhibits temperature-dependent induction of gene expression in
Schizosaccharomyces pombe. Yeast 23: 55–65.
Matsuyama A, Arai R, Yashiroda Y, et al. 2006. ORFeome
cloning and global analysis of protein localization in the
fission yeast Schizosaccharomyces pombe. Nat Biotechnol 24:
841–847.
Yeast 2008; 25: 371–376.
DOI: 10.1002/yea
376
Matsuyama A, Shirai A, Yashiroda Y, et al. 2004. pDUAL,
a multipurpose, multicopy vector capable of chromosomal
integration in fission yeast. Yeast 21: 1289–1305.
Matsuyama A, Yabana N, Watanabe Y, Yamamoto M. 2000.
Schizosaccharomyces pombe Ste7p is required for both
promotion and withholding of the entry to meiosis. Genetics
155: 539–549.
Maundrell K. 1990. nmt1 of fission yeast. A highly transcribed
gene completely repressed by thiamine. J Biol Chem 265:
10857–10864.
Rustici G, Mata J, Kivinen K, et al. 2004. Periodic gene
expression program of the fission yeast cell cycle. Nat Genet
36: 809–817.
Copyright  2008 John Wiley & Sons, Ltd.
A. Matsuyama et al.
Siam R, Dolan WP, Forsburg SL. 2004. Choosing and using
Schizosaccharomyces pombe plasmids. Methods 33: 189–198.
Toyama R, Bende SM, Dhar R. 1992. Transcriptional activity
of the human immunodeficiency virus-1 LTR promoter in
fission yeast Schizosaccharomyces pombe. Nucleic Acids Res 20:
2591–2596.
Toyama R, Okayama H. 1990. Human chorionic gonadotropin
alpha and human cytomegalovirus promoters are extremely
active in the fission yeast Schizosaccharomyces pombe. FEBS
Lett 268: 217–221.
Yeast 2008; 25: 371–376.
DOI: 10.1002/yea