Download Microsatellite Repeat Variation Within the y1 Gene of Maize and

Microsatellite Repeat
Variation Within the y1
Gene of Maize and Teosinte
T. L. Phelps, A. E. Hall, and
B. Buckner
We have sequenced a (CCA),, microsatellite-containing region of the y1 gene from
11 different lines of maize and 6 teosinte
species, subspecies, or varieties. The
(CCA)n microsatellite was found to vary in
repeat number from 3 to 11. In addition, a
pentanucleotide repeat adjacent to the trinucleotide microsatellite exhibits sequence and repeat number variation.
Therefore, the (CCA)n microsatellite, as
well as the sequence directly adjacent to
it, exhibit variability in both maize and teosinte and could potentially serve as molecular markers in mapping or breeding
studies.
Carotenoids are yellow-orange compounds
that constitute one of the most widespread groups of pigments found in nature
[reviewed by Goodwin (1971)]. In maize,
many genes have been identified that influence the production of carotenoids in
the kernel and leaf [reviewed by Robertson (1975)]. Most often when a plant is homozygous for a recessive allele of one of
these genes the kernel will accumulate carotenoid precursors. Since carotenoids
are precursors of the phytohormone abscisic acid (ABA; Parry and Horgan 1991)
these kernels contain reduced amounts of
ABA (Neill et al. 1986), do not become
dormant, and germinate on the cob as albino seedlings which is a lethal phenotype. The yl gene of maize is involved in
the production of carotenoids (Mangelsdorf and Fraps 1931), however, no allele of
yl which conditions a lethal phenotype
has been reported. Therefore, the yl gene
is a useful gene for study when breeding
maize for carotenoid content.
The yl gene of maize codes for phytoene synthase, an enzyme that condenses
two geranyl-geranyl pyrophosphate molecules into one molecule of phytoene during the biosynthesis of carotenoids (Buckner et al. 1996). Plants that contain a dominant allele of yl have yellow kernels as a
result of the accumulation of carotenoids.
Plants homozygous for a recessive allele
of yl have pale-yellow to white kernels
that contain significantly less carotenoids
than kernels from plants that contain a
dominant allele of yl (Buckner et al.
1996). While there have been many alleles
3 9 6 The Journal of Heredity 1996-87(5)
of yl reported in maize (Buckner et al.
1990; Robertson 1985; Robertson and Anderson 1961), no detailed analysis of the
genetic diversity at the yl locus has been
made in teosinte, the putative progenitor
of maize. Teosinte is a wild grass from
Mexico and Guatemala that exhibits various plant forms (annual and perennial),
ploidy levels (2N and AN) and cytogenetic
characteristics [reviewed by Galinat
(1988)]. Three of the four annual teosintes
are classified as two subspecies of Zea
mays (i.e., ssp. mexicana and ssp. parviglumis) and the Z mays variety huehuetenangensis. The remaining annual teosinte is
considered a separate species, Z luxurians, as are the perennial teosintes Z perennis and Z diploperennis (Doebley and IItis 1980; Iltis and Doebley 1980). The Guatemalan teosinte Z luxurians, which was
studied by Robertson (1987), was found to
be homozygous for a recessive allele of yl.
A dominant yl allele of maize cloned by
Buckner et al. (1990) was sequenced and
molecularly characterized (Buckner et al.
1996). These studies revealed that multiple transcriptional initiation sites are present in this allele. Of these multiple sites,
the one closest to the translational start
codon appeared to be used preferentially.
In addition, a (CCA),, microsatellite was
found to be repeated 11 times 11 bp upstream of this transcriptional initiation
site. Trinucleotide repeats are a common
type of microsatellite repeat found in
plants (Wang et al. 1994). Allele-specific
length polymorphisms of microsatellites
are known to exist in many plants including maize (Senior and Heun 1993), rice
(Wu and Tanksley 1993; Zhao and Kochert
1993), barley (Maroof et al. 1994), soybean
(Akkaya et al. 1992; Morgante and Oliveri
1993), and arabidopsis (Bell and Ecker
1994). The prevalence, high degree of repeat number variability, and Mendelian inheritance have made microsatellites useful markers for genome mapping (Akkaya
et al. 1992; Bell and Ecker 1994; Senior and
Heun 1993; Zhao and Kochert 1993), genotype identification (Rongwen et al.
1995), plant breeding studies (Devos et al.
1995), and studies to assess relatedness
and genetic diversity (Dow et al. 1995).
Materials and Methods
Genetic Material
The yl allele present in the maize stock
designated Q60, which is a hybrid of inbred lines Q66 and Q67, was previously
cloned (Buckner et al. 1990) and sequenced (Buckner et al. 1996). The yl al-
lele present in inbred lines H99, M14, and
B73 were also analyzed in this study. The
stock containing the standard recessive allele of yl was previously described by
Buckner et al. (1990). A stock containing
the recessive allele yl-lemon yellow was
provided by G. F. Sprague (University of
Illinois, Urbana, Illinois). The stocks containing the alleles yl-8549 and yl-wmut
were previously described (Robertson
and Anderson 1961). Stocks of Black Mexican Sweet, Knobless Wilber's Flint, and
Strawberry popcorn were provided by the
Maize Genetics Cooperative (Urbana, Illinois). All teosinte stocks analyzed in this
study (see Table 1 for accession numbers)
were provided by the USDA, ARS Regional
Plant Introduction Station at Ames, Iowa.
Polymerase Chain Reaction (PCR)
DNA isolations were performed by using
the micropreparative method of Dellaporta (1994). DNA was isolated from individual etiolated shoots grown for 3-5 days at
30°C on germination paper saturated with
1 mM CaCl2. The oligonucleotide primers
flanking the (CCA)n repeat were 5'-(CAAGAAGAGGAGAGGCCGGA)-3' and 5'-(TTGA
GCAGGGTGGAGCACTG)-3'. PCR reactions
were performed in 50 |xl with approximately 0.1 (jig of genomic maize DNA. The
reaction mix contained l x PCR buffer (10
mM Tris-HCl, pH 8.3, 50 mM KC1, 1.5 mM
MgCl2, and 0.01% gelatin), 200 jiM of each
dNTP, and 1.25 units of Taq polymerase
(Perkin Elmer Co., Norwalk, Connecticut).
The reaction mix was incubated in a Hybaid® thermal cycler (National Labnet
Co., Woodbridge, New Jersey) by using the
following parameters: 94°C for 1 min, 59°C
for 1 min, 72°C for 30 sec. After 30 cycles
the samples remained at 72°C for 5 min.
Based on the sequence of the cloned allele
of yl (Buckner et al. 1990) the resulting
PCR product should be approximately 228
bp long. PCR reactions at a series of pH
and Mg++ concentrations were performed
using Invitrogen's PCR Optimizer Kit (San
Diego, California).
Gel Electrophoresis and DNA Blot
Hybridization
The PCR products were resolved on 2.5%
Metaphor® agarose (FMC Bio Products,
Rockland, Maine) gels made in 0.09 M Tris,
0.09 M boric acid, and 2 mM EDTA. The
molecular length standard used for these
studies was the 1 kb ladder (Life Technologies, Gaithersburg, Maryland). The DNA
was blotted to nylon membranes (Micron
Separations Inc., Westboro, Massachusetts), hybridized with 2 ng of digoxigenin-
labeled yl DNA per milliliter of hybridization solution, and the hybridization signal
detected as described by Rocheford and
Wallace (1991). The DNA hybridization
probe used in this study was a 1.2 kb
Mndlll-fiamHI fragment that was isolated
from the cloned yl gene previously described by Buckner et al. (1990). This hybridization probe contains the (CCA)n microsatellite as well as flanking DNA sequences.
DNA Sequencing
PCR products were excised from 1.2%
Seakem low-gelling agarose (FMC Bio
Products, Rockland, Maine) gels made in
40 mM Tris-acetate and 1 mM EDTA, pH
7.8, and purified using Wizard® PCR Preps
DNA Purification System (Promega, Madison, Wisconsin). Approximately 12 ng of
purified PCR products were sequenced using the primer 5'-(TTGAGCAGGGTGGAGCACTG)-3' and an Applied Biosystems
Inc. (ABI, Forrest City, California) Taq
DyeDeoxy® Terminator Cycle Sequencing
Kit as described by the manufacturer. The
extension products were purified by Sephadex G50 Quick Spin® columns (Boehringer Mannheim, Indianapolis, Indiana)
and separated on a 6% polyacrylamide gel
made in 0.09 M Tris, 0.09 M boric acid, 2
mM EDTA, and 7 M urea. The sequence of
the extension products was detected using a 373A ABI (Forrest City, California)
automated sequencing apparatus. All sequence data were derived from no less
than two independent PCR amplifications.
a)
2
10
b)
2
10
Figure 1. Length polymorphisms of PCR products visualized on ethidium bromide stained Metaphor® agarose
gel (a) and by DNA blot hybridization (b). Lane 2: Z. luxurians; lane 3: yl-lemon yellow, lane 4: standard recessive
allele of yl; lane 5: B73; lane 6: M14; lane 7: yl-8549; lane 8: H99; and lane 9: Q60. Lanes 1 and 10 are the 396, 344,
298, 220, 201, 154, and 134 bp DNA fragments of the 1 kb DNA ladder (a) and representations of the 396, 344, 298,
220, and 201 bp fragments of the 1 kb DNA ladder (b).
Results and Discussion
We have used the PCR to amplify and then
sequence a region of the yl gene of maize
and teosinte which was known to contain
the trinucleotide (CCA)n repeated 11 times
within a maize allele cloned from the hybrid line Q60. Eleven different maize lines
and one or two accessions of six teosinte
species, subspecies, or varieties were analyzed. By electrophoresis on 2.5% Metaphor® agarose gels (FMC Bio Products,
Rockland, Maine) we were able to resolve
length polymorphism between many of
the alleles we studied (Figure 1). In the
maize line Q60, three PCR products could
be resolved (Figure la, lane 9). DNA from
line Q60 was amplified by the PCR at a series of pH and Mg++ concentrations. Under these conditions either all three PCR
products or none were detected (data not
shown). Occasionally the PCR of the other
alleles studied contained minor products
in addition to the amplified DNA that was
consistently found. DNA- blot hybridization was performed to verify that the PCR
products were amplifications of the target
region of yl. The 1.2 kb ///ndlll-Bom.HI
cloned yl sequence hybridized to all of
the PCR products that were visible on
ethidium bromide stained gels (Figure 1).
These minor bands should not present a
serious obstacle to using this DNA as a
molecular marker.
Sequencing these PCR products demonstrated that the (CCA)n microsatellite
varies in repeat number from 3 to 11 (Figure 2 and Table 1). These sequence analyses also demonstrate that the (CCA)n repeat is flanked by the imperfect pentanucleotide repeat (PyCATC; Py = C or T). In
fact, the last (CCA)n can be considered
part of this pentanucleotide repeat (i.e.,
CCATC). Three different organizations of
the pentanucleotide repeat were observed
(designated types 1, 2, and 3 in Table 1).
Type 1 contains both the (CCATC) and
(TCATC) sequence duplicated as well as a
trinucleotide CTG repeated 33 bp 5' of the
(CCA)n repeat. Types 2 and 3 contain three
copies of the pentanucleotide repeat but
differ by a single base in the first repeat.
We have further subdivided these categories based on the number of (CCA)n repeats found. The only sequence variability
found within the (CCA)n repeat was a C to
T transition in the second and fifth (CCA)n
repeats of type 3a and 3c, respectively. In
total, 12 different sequence polymorphisms
were observed in this study (Figure 2 and
Table 1). Therefore, the (CCA)n microsatellite, as well as the sequence directly adjacent to it, exhibit a high degree of variability.
Each of the annual teosinte types analyzed in this study can be distinguished
based on the sequence of the microsatellite-containing region of yl (Figure 2 and
Brief Communications 3 9 7
8|8
M?f
CGGAGGTGCGCGJGCTCCTTGCTGCTGTTCTGCTGACTGGTCTCACCATC
*********************___**************************
yi*8549
*********************—iiiiiiiiiiitiiiiitiiititi;
yi-wmut
*********************——z**zzz*z*zzzzz************
nd
l-fem
il*****ti************--—*****•***************----^f ^fflf^T ^P ^^ ^t 1^ ^T IK ^t ^T ^T W ^T ^T ^T ^^ ^* ^T ^T dw *» ^™ ^* ^* ^* ^* ^* ^* ^* ^^ ^* ^* ^* ^* ^* ^* ^* ^* ^* ^ ^^ ^^ ^~
^^ ^J *3
" ^^ **
y
BMS
RWF
*********************———*********************—————
*********************
:::: : ::==********************* :===:
i:gi^iior****-*****
" H •*H**HHH:iH:::*:**
Z .par
*********************
****** ******* ******——--—
Z
ft/384060)*********************-——***********************
Z ml566G811 *********T**********C
*******T***C********G*****
ZP121875) ********************* — * * * * * * * T * * * C * * * * * * * * *
g".|l21881J j;;ji;;;tj;;jjj;;;jjt;;ijt;ii;;;tt;;;;;jjt;jjiiiii
zli
********************* *********************
Ml 4
*****___—_*••******•*****************—•»—**********
^^ ^^ ^_ ^C ^^ ^J IJ
^T ^T ^* ^t ^t ^^ 4^ ^a ^» ^B ^T ^T ^T ^t * ^* ^* 1" ^* ^^ ^* W » ^* ^* ^* ^* ^T ^* ^% ^* ^* W W ^w ^m ^K ^^ ^^ ^^ ^* ^T ^T ^T ^ ^* ^* W ^T ^T
vl-wmut
*****
|!ls
***************************
**********
*:::*=7x^:::*::::::**;:::::::::::::::::::::::c**:
BMS
**********************T**
******C***
Straw
**********************T**
J1IJIJSI1J
^T
Wf ^c ^T ^T W ^« ^t ^T ^^ ^T ^* ^T aV ^« ^T ^» ^m ^m ^T ^T ^* ^w ^ ^ ^ ^ ^» ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^» ^ * ^ " ^ ^ ^ ^ ^» ^ ^ ^ * ^ ^ ^
Z
Z .. h
h (( 42 41 1898304) ) **************************TT************************************************************************
Z . O£LX
* * * * + *******************#***^^^^^^^^^i—^^**********
Z.m( 3 8 4 0 6 0 ) * * * * *
***************
**********
Z.n>{ 5 6 6 6 8 1 ) * * * * *
***************
1*.*.*.*.*.*.*.*.*.
Z.p J21875J ****** * * " * * * " • I ****T**
**•***$•**
g.o(21881) ;;;;i;:*********:_::iiii;iiiiiiiiiin::i**********
T^
8 6g g0
Jl^i ^
—854 9
^
^^ V ^ ^ P ^ ^ i ^ H
# ^3
yl-stand
yl-lem
^*
^ ^ ** ^" ^
"^ ^*
GATAAGATAGCAAATATATGGCCATCATACTCGTACGAGCAGCGTCGCCG
**************************************************
* * * * * * * * * * * * * * * * * * * * * * * * * w W * * * W W W w * * W W W W W ^ ^ w W w W w ^ W
**************************************************
•
*
^^ ^^
^^
^^
rt
^ T 1 w ^w ifr ^* VT ^ T "" ^* ^^ ^* ^* ^* ^ f *^ "" *^ * ^ <" ^* ^* W VT ^ T ^* ^* ^w ^w w
^^
^^
^^
^^ ^ ^
^^ ^^
^^
^^ ^ ^
^^
^^
^^ ^ ^
^^
^^
^^ ^^ ^^ ^^
^^
^^
^^
^ ^ ^^
^^
^^
^^
^^
^K
rt
^^ ^^
^^
^m ^m ^K rt
** "
^* ^% ^W ^« ^ T ^* ^C W^ w
^* w
^¥
•! ^ T
**************************************************
**************************************************
BMS
Z*'*Z*'**Z*'Z*'$t$ZZZZZ$ZZZZZZ*'ZZtZZZZllZZZZZ*ZZ*'*'Z***
Z.h(441934)**************************************************
Z.h (21880) ******J**J*J*******5**;*iII**j;*I*JIJiiIi*II*m**
z!m(384060)***********************************************?**
Z .mj56 6 681>**************************"******G******~*********
2,^
****g*********************************************
Figure 2. Sequence of the microsatellite-containing region of the yl gene of maize and teosinte. The genetic
material analyzed were those described in Materials and Methods and in Table 1. Abbreviations are as follows:
yl-stand: standard recessive allele of yl; yl-lem: yUemon yellow; BMS: Black Mexican Sweet; Straw: Strawberry
popcorn; KWF: Knobless Wilber's Flint; Z.h (441934): Z. mays var. huehuetenangensis (PI 441934); Z.h (21880): Z.
mays var. huehuetenangensis (Ames 21880); Z.par: Z mays ssp. parviglumis; Z.m (384060): Z mays ssp. mexicana
(PI 384060); Z.m (566681): Z. mays ssp. mexicana (PI 566681); Z.p (21875): Z perenms (Ames 21875); Z.p (21881):
Z. perennis (Ames 21881), Z.d: Z. diploperenms; Z.I: Z. luxurians. An asterisk indicates the same base as that found
in the Q60 allele. A hyphen indicates the base found in the Q60 allele was not present.
Table 1. Sequence organization of the microsatellite-containing region of the yl gene of maize and
teosinte
Type
1
2a
2b
2c
3a
3b
3C
Organization of pentanucleotide repeat
flanking (CCA), microsatellite
repeat in yl
CCATC
CCATC
CCATC
CCATC
TCATC
TCATC
TCATC
TCATC
TCATC
TCATC
TCATC
(CCA), Genetic material and sequence identity
TCATC (CCA)n
(CCA) n
(CCA),,
(CCA),
TCATC (CCA)n
TCATC (CCA)O
TCATC (CCA),,
CCATC
CCATC
CCATC
CCATC
CTATC
CTATC
CTATC
11
10
8
6
11
7
6
3d
TCATC TCATC (CCA)O
CTATC
3
3e
TCATC TCATC (CCA)B
CTATC
5
Q60 = H99
M14 = y 1-8549 = yl-wmut
B73 = standard yl
Z. mexicana (PI 384060) # (PI 566681)
Z huehuetenangensis (PI 441934) # (Ames 21880)
Z parviglumis (PI 331786)
yNemonyellow = Black Mexican Sweet =
Strawberry popcorn = Knobless Wilber's Flint s4
Z. perennis (Ames 21875)
Z diploperennis (PI 462368) = (Ames 2317) =
Z perennis (Ames 21881)
Z. luxurians (Ames 21876) = (Ames 311282)
" =, the sequences presented in Figure 1 are identical; ^ , sequences are not identical.
3 9 8 The Journal of Heredity 1996:87(5)
Table 1). In addition, sequence polymorphisms that flank the microsatellite region
of yl allow the two accessions of Z. mays
ssp. mexicana and Z mays var. huehuetenangensis to be distinguished (Figure 2 and
Table 1). The perennial teosintes Z. diploperennis and Z. perennis (Ames 21881)
were found to exhibit the type 3d organization of the pentanucleotide repeat with
three (CCA) repeats, which was the least
number of repeats observed. However, another accession of Z perennis (i.e., Ames
21875) exhibited type 3c organization of
the pentanucleotide repeat containing six
(CCA) repeats. Therefore, the (CCA)n repeat number is variable within this Zea
species. Interestingly, the sequence flanking this region in Z perennis Ames 21875
could be distinguished from that of the Z
mays ssp. mays type 3c sequences by
polymorphisms that flank the microsatellite (Figure 2 and Table 1). Further analysis of teosinte will be necessary to determine if the degree of variability in this region of the yl gene is sufficient to make it
a good marker for studying genetic variability within and among populations of
teosinte.
Carotenoids in the kernel of maize can
be both a desirable trait, as they serve as
a source of provitamin A (Mangelsdorf
and Fraps 1931), and an undesirable trait,
due to their unwanted coloration of certain maize products. Therefore, carotenoid content is an important consideration in many maize breeding programs.
The amount of carotenoids present in the
kernels of commercial lines of maize is, to
a large part, determined by the allelic constitution of yl which conditions kernel color that ranges from white to intense orange (Buckner B, personal observation). A
large number of alleles of yl are known to
exist in maize (Buckner et al. 1990; Robertson 1985; Robertson and Anderson
1961), and the present study indicates
that teosinte is also a potential source of
added genetic diversity at this locus. In
addition, in plant breeding studies it is often desirable to assess the genotype of
large numbers of plants prior to crossing
them. The sequence variability detected in
this study suggests that PCR amplification
of the microsatellite region of yl followed
by gel electrophoresis on Metaphor® agarose or polyacrylamide is a simple and affordable method to assess the genotype of
this locus.
From the Division of Science, Northeast Missouri State
University, Kirksville, MO 63501. The authors thank the
1994 and 1995 Eukaryotic Molecular Genetics Course
members for preliminary PCR analyses of several al-
leles of yl. We also would like to thank J. L. Bennetzen
and P. San Miguel, Department of Biological Sciences,
Purdue University, for sharing sequence data prior to
publication and D. Janick-Buckner for critical evaluation of this manuscript. This work was supported by
an NMSU summer research stipend and two Sigma Xi
grant-in-aid of research from Sigma Xi, The Scientific
Research Society to T.L.P., and NMSU academic and
summer faculty research grants to B.B.
The Journal of Heredity 1996:87(5)
References
Akkaya MS, Bhagwat AA, and Cregan PB, 1992. Length
polymorphisms of simple sequence repeat DNA in soybean. Genetics 132:1131-1139.
Bell CJ and Ecker JR, 1994. Assignment of 30 microsatellite loci to the linkage map of Ambidopsis. Genomics
19:137-144.
Buckner B, Kelson T, and Robertson DS, 1990. Cloning
of the yl locus of maize, a gene involved in the biosynthesis of carotenoids. Plant Cell 2:867-876.
Buckner B, San Miguel P, Janick-Buckner D, and Bennetzen JL, 1996. The yl gene of maize codes for phytoene synthase. Genetics 143:479-488.
Dellaporta S, 1994. Plant DNA miniprep and microprep:
versions 2.1-2.3. In: The maize handbook (Freeling M
and Walbot V, eds). New York: Springer-Verlag; 522-525.
Devos KM, Bryan GJ, Collins AJ, Stephenson P, and Gale
MD, 1995. Application of two microsatellite sequences
in wheat storage proteins as molecular markers. Theor
Appl Genet 90:247-252.
Doebley JF and lltis HH, 1980. Taxonomy of Zea (Gramineae). I. Subspecies classification with key to taxa.
Am J Bot 67:986-993.
Robertson DS and Anderson IC, 1961. Temperature sensitive alleles of the yl locus in maize. J Hered 52:53-60.
Rocheford T and Wallace N, 1991. Chemiluminescent
Southern detection of maize genomic single copy sequences. Maize Gen Coop Newslett 65:111-113.
Rongwen J, Akkaya MS, Bhagwat AA, Lavi U, and Cregan PB, 1995. The use of microsatellite DNA markers
for soybean genotype identification. Theor Appl Genet
90:43-48.
Senior ML and Heun M, 1993. Mapping maize microsatellites and polymerase chain reaction confirmation of
the targeted repeats using a CT primer. Genome 36:
884-889.
Wang Z, Weber JL, Zhong G, and Tanksley SD, 1994.
Survey of plant short tandem DNA repeats. Theor Appl
Genet 88:1-6.
Wu K and Tanksley SD, 1993. Abundance, polymorphism and genetic mapping of microsatellites in rice.
Mol Gen Genet 241:225-235.
Zhao X and Kochert G, 1993. Phylogenetic distribution
and genetic mapping of a (GGC)n microsatellite from
rice (Oryza sativa L). Plant Molec Biol 21:607-614.
Received August 28, 1995
Accepted December 31, 1995
Corresponding Editor: Stephen J. O'Brien
The Use of Transposable
P-elements of Drosophila
melanogaster for
Introductory Genetics
Laboratory Courses
Dow BD, Ashely MV, and Howe HF, 1995. Characterization of highly variable (GA/CT)n microsatellites in the
bur oak, Quercus macrocarpa. Theor Appl Genet 91: P. Morcillo, R. Turtle, and R. J.
137-141.
Maclntyre
Galinat WL, 1988. The origin of corn. In: Corn and corn
improvement (Sprague GF, ed). Madison.Wisconsin:
Laboratories in introductory genetics coursAgronomy Society of America; 1-31.
Goodwin TW, 1971. Biosynthesis. In: Carotenoids (Isler
O, ed). Basel: Birkhauser Verlag; 577-636.
lltis HH and Doebley JF, 1980. Taxonomy of Zea (Gramineae). II. Subspecies categories in the Zea mays complex and a generic synopsis. Am J Bot 67:994-1004.
Mangelsdorf PC and Fraps GS, 1931. A direct quantitative relationship between vitamin A in corn and the
number of genes for yellow pigmentation. Science 73:
241-242.
Maroof MA, Biyashev RM, Yang GP, Zhang Q, and Allard
RW, 1994. Extraordinarily polymorphic microsatellite
DNA in barley: species diversity, chromosomal locations, and population dynamics. Proc Natl Acad Sci
USA 91:5466-5470.
Morgante M and Olivieri AM, 1993. PCR-amplified microsatellites as markers in plant genetics. Plant J 3:175182.
Neill JS, Horgan R, and Parry AD, 1986. The carotenoid
and abscisic acid content of viviparous kernels and
seedlings of Zea mays L. Planta 169:87-96.
Parry AD and Horgan R 1991. Carotenoids and abscisic
acid (ABA) biosynthesis in higher plants. Physiol Plant
82:320-326.
Robertson DS, 1975. Survey of the albino and whiteendosperm mutants of maize. Their phenotype and
gene symbols. J Hered 66:67-74.
Robertson DS, 1985. Differential activity of the maize
mutator Mu at different loci and in different cell lineages. Mol Gen Genet 200:9-13.
Robertson DS, 1987. Some thoughts about the nature
of Afu-induced Yl mutants. Maize Gen Coop Newslett
61:9-10.
es often use Drosophila melanogaster as a
tool for the students to understand how
genes are transmitted and mapped. We
demonstrate three advantages of using
P-element containing inserts with the wildtype alleles of the genes to be mapped.
First, inserts can be positioned at many
places in the genome with relative ease;
second, stocks can be chosen which have
excellent viability; and third, inserts can be
selected for precision in mapping with regard to marker genes. The results of a preliminary test with a beginning genetics laboratory are presented. The inserts exhibit
excellent Mendelian ratios in F2 and backcross progeny and were reproducibly
mapped by different student groups.
At Cornell University, where some 400 students take the genetics course and its required laboratory each year, the students
have mapped four different mutant genes
in an "unknown" stock of Drosophila melanogaster. Two of these genes are eye color mutations, one a body color mutation,
and one a wing vein mutation. The number of mutant genes in the unknown stock,
the dominance or recessiveness of the mutant alleles, their autosomal versus sexlinked locations, and some indication of
linkage relationships are determined from
the F, and F2 of reciprocal crosses between the unknown and a wild-type strain.
To map autosomal genes, the unknowns
are crossed to marker stocks with two
dominant mutations either on the second
or third chromosome. Mutant genes on
the X chromosome are mapped relative to
crossveinless and forked.
Over the years, we have encountered
several problems when using these "unknown" stocks in the genetics laboratory.
First, only a few mutant genes with each
kind of phenotype are available, limiting
the number of "unknown" stocks we can
construct. In practice we have used only
two body color genes [black (6) and ebony
(e)], three wing vein genes [radius incomplete (ri), veinlet (ve), and short vein (shv)],
and seven eye color genes [white (w),
white-Brownex (m8"*), brown (bw), scarlet
(sf), claret (cd), cinnabar (en), and vermilion
(v)]. The unknowns in our current set have
white eyes, due to homozygosity for mutants in the brown and red pigment pathways (e.g., bw st, wBwx v) or due to the epistatic effect of white on a second eye color
gene (e.g., w v, w cd). Of the 84 possible
combinations of these wing vein, body color, and eye color mutant genes (2 X 3 X
14), we have used only 30 at different times
over the past 10 years. Second, it has been
our experience, even though the unknown
stocks used by a particular class are phenotypically identical yet genotypically
unique (Maclntyre 1974), the students can
pass the information obtained from the
mapping of these mutants to students in
following semesters, thus creating some
potential for cheating. Third, the students
have difficulty in mapping genes whose distance is greater than 30 map units (mu)
from the nearest marker, due to the fact
that the unrecognized double crossover
classes are missing from the calculations.
Fourth, the different mutant F2 genotypes
have different viabilities, often skewing expected Mendelian ratios. Thus, different
student pairs can be at a relative disadvantage with respect to those students whose
"unknown" contains mutant genes close to
the markers or whose mutants are relatively healthy. Because of these problems, we
have taken a new approach, using transposable P-helements that contain a gene of
interest in the "unknown" stocks.
The technique of P-element mediated
transformation, introduced by Rubin and
Spradling (1982) allows us to transform
Brief Communications 3 9 9