Download H28+C Insertion in the CYP21 Gene: A Novel Frameshift Mutation in

0013-7227/01/$03.00/0
Printed in U.S.A.
The Journal of Clinical Endocrinology & Metabolism 86(12):5877–5880
Copyright © 2001 by The Endocrine Society
H28ⴙC Insertion in the CYP21 Gene: A Novel Frameshift
Mutation in a Brazilian Patient with the Classical Form
of 21-Hydroxylase Deficiency
IVY F. LAU, FERNANDA C. SOARDI, SOFIA H. V. LEMOS-MARINI, GIL GUERRA JR.,
MARIA TEREZA M. BAPTISTA, AND MARICILDA P. DE MELLO
Centro de Biologia Molecular e Engenharia Genética (I.F.L., F.C.S., M.P.D.M.); Departamento de Pediatria/Centro de
Investigação em Pediatria (S.H.V.L.-M., G.G.); and Disciplina de Endocrinologia-Faculdade de Ciências Médicas
(M.T.M.B.), Universidade Estadual de Campinas, 13083-970 Campinas, São Paulo, Brasil
In the classical form of 21-hydroxylase deficiency, CYP21affected genes either carry mutations present in the CYP21P
pseudogene (microconversions) or bear a chimeric gene that
replaces the active gene as a result of large conversion or
deletion mutational events. Previous genotyping of 41 Brazilian patients revealed 64% microconversion, whereas deletions and large gene conversions accounted for up to 21% of
the molecular defect. The present paper describes a new mutation disclosed by sequencing an entire gene in which no
C
ONGENITAL ADRENAL HYPERPLASIA (CAH) due
to 21-hydroxylase deficiency is one of the most common inborn errors of metabolism. The classical form of 21hydroxylase deficiency may result in two distinct phenotypes: salt-wasting (SW) and simple virilizing (SV). Cortisol
biosynthesis is impaired in both SW and SV forms (1). The
main consequence is an increased production of androgens,
generally causing ambiguous external genitalia at birth in
females, precocious puberty in males, and acceleration of
somatic growth in both males and females. The SW form also
involves impairment of aldosterone production, causing failure to thrive and dehydration due to salt loss (1).
Gene deletions, gene conversions, and mutations normally
present in the pseudogene account for 90 –95% of the diseasecausing alleles in all populations (1). Therefore, about 5–10%
of 21-hydroxylase-deficient alleles do not bear any of the nine
most frequent mutations related to the classical form. To
date, a total of 52 CYP21 gene mutations have been deposited
in the Cardiff Human Gene Mutation Database (2). More
than 30 mutations are rare and have been described in specific families with SW- or SV-affected children (3–14). Although the great majority of rare mutations are considered
to be present only in the CYP21 gene, some of them can be
found in some CYP21P alleles, according to Wedell and Luthman (15).
In two previous papers (16, 17), the results of deletions,
gene conversions, and microconversion analyses involving a
total of 41 Brazilian families with children presenting the
classical form of 21-hydroxylase deficiency were reported.
Twenty-one percent of the affected alleles showed deletion
Abbreviations: ASO, Allele-specific oligonucleotide; CAH, congenital
adrenal hyperplasia; SV, simple virilizing; SW, salt-wasting.
pseudogene-originated mutation had been found. The patient
with the classical form of 21-hydroxylase deficiency is the
daughter of a consanguineous marriage, and she is homozygous for a novel frameshift H28ⴙC within exon 1. The mutation causes a stop codon at amino acid 78. Both parents are
heterozygous for the mutation as confirmed by allele-specific
oligonucleotide PCR. The H28ⴙC is not present in the published CYP21P sequences and is likely to result in an enzyme
with no activity. (J Clin Endocrinol Metab 86: 5877–5880, 2001)
or large gene conversion, 64% carried microconversions, and
15% remained undetermined. This paper describes one novel
mutation found in a homozygous patient with no pseudogene-originated mutation.
Materials and Methods
The study was undertaken under an institutionally approved protocol, and informed consent was obtained from all subjects.
Patient
A Caucasian girl was delivered normally after the uneventful pregnancy of a 33-yr-old mother. Parents are first-degree cousins, and both
are healthy. CAH was diagnosed in the patient’s second week of life. She
had clitoromegaly, complete fusion of the labioscrotal folds (Prader
grade III), no palpable gonads, hyponatremia (Na 126 mEq/liter), and
high levels of urinary 17-ketosteroids, and she failed to thrive. Treatment
with oral prednisone and fludrocortisone was started. Clitoroplasty and
vaginoplasty were performed twice at the ages of 1 and 8 yr. In our first
examination, at the age of 7, her bone age was 9 yr of age, according to
Greulich and Pyle’s method; she weighed 20.5 kg (z ⫽ ⫺0.07), her height
was 113.5 cm (z ⫽ ⫺0.82), and she had clitoral enlargement (3 cm) with
posterior fusion of the labioscrotal folds but no acne or hirsutism. The
karyotype was 46,XX. After treatment with prednisone and fludrocortisone, neither dehydration nor abnormal plasmatic renin activity has
occurred. She had normal puberty (menarche at 12). At age 14, the
patient decided to stop the treatment and went 4 months without medication. During that period she had no clinical symptoms of adrenal
insufficiency, but when she returned for treatment she presented dark
skin, irregular menses, and high 17-hydroxyprogesterone and androstenedione4 serum levels with normal plasmatic renin activity.
DNA analysis
CYP21 gene was amplified from genomic DNA into two segments
by PCR using selective primers (18) (Table 1). Internal primers were
used in the sequencing reactions or in nested-PCR before the sequencing procedures (Table 1). The amplified fragments were treated
with the PCR Product Pre-sequencing Kit (Amersham Pharmacia
5877
5878
J Clin Endocrinol Metab, December 2001, 86(12):5877–5880
Lau et al. • Novel Mutation on CYP21-Affected Alleles
TABLE 1. CYP21 gene primers used in PCR and sequencing
Purpose
Primer
CYP21 gene selection
Ex6naa
Ex6nsa
5⬘21B1s
Int10as
5⬘21B2
ProEx1s
Int1as
Int2as
Int2s
Ex3nsa
Ex3nasa
Int3as
Int4as
Int4s
Int6as
Int6s
Int7as
Int7s
Int8as
Ex81naa
21Bex9s
Int2/Aa
Int2/Ca
Int2/Ga
H28norsense
H28mutsense
Sequencing
ASO-PCR
Sequence (5⬘–3⬘)
AGCTGCATCTCCACGATGTGA
GAGGGATCACATCGTGGAGATG
GAGTGAGTGCCCACAAAGC
GAAACTGAGGTACCCGGC
AGTAAACTGGCCCACGGTG
GGATGGCTGGGGCTCTTGAG
CAGCCAAAGCAGCGTCAGCG
CACACTTGAGGCTGAGGTGG
CCTTCATCAGTTCCCACCCTC
CGGACCTGTCCTTGGGAGACTAC
TCCAGAGCAGGGAGTAGTCTC
CTGTGAGAGGCGAGGCTGAC
CAGTTCAGGACAAGGAGAGGC
GTGCCTCACAGCCCCTCAG
GGTGAAAGGAGCGGGCTGAG
CAGTGATGCTACCGGCCTC
CAGAGCTGAGTGAGGGTG
CCGGCACTCAGGCTCACT
GGGCTGGAGTTAGAGGCTGG
TTCGTGGTCTAGCTCCTCCTG
TTGGGGATGAGTGAGGAAAG
TTCCCACCCTCCAGCCCCCAA
TTCCCACCCTCCAGCCCCCAC
TTCCCACCCTCCAGCCCCCAG
GAAGCTCCGGAGCCTCCACC
GAAGCTCCGGAGCCTCCCAC
Tm (C)
Nucleotide position
64.0
63.0
60.0
58.0
60.0
66.0
66.0
64.0
60.0
70.0
70.0
60.0
62.0
64.0
66.0
62.0
60.0
60.0
62.0
67.0
60.0
70.0
70.0
70.0
68.0
68.0
1380 –1400
1373–1395
(⫺655)–(⫺637)
2732–2749
(⫺352)–(⫺334)
(⫺58)–(⫺39)
272–291
498 –517
629 – 649
692–714
707–727
856 – 875
1078 –1098
1036 –1054
1555–1574
1454 –1472
1841–1858
1891–1908
2219 –2238
1999 –2019
2177–2196
635– 656
635– 656
635– 656
66 – 85
66 – 85
s, Sense; as, antisense; Ex, exon; Int, intron. Numbers in primer names indicate the corresponding exon or intron.
Primers described by Wilson et al. (18).
a
Biotech, Arlington Heights, IL) and were directly sequenced with
Thermo-Sequenase Radiolabeled Terminator Cycle Sequencing Kit
(Amersham Pharmacia Biotech). Sequencing data were compared
with the CYP21 gene sequence described by Higashi et al. (19)
(GenBank Accession no. M12792).
Allele-specific oligonucleotide (ASO)-PCR analysis for 656A/C3 G
polymorphism/mutation was carried out as described by Wilson et al.
(18), whereas the ASO-PCR for H28⫹C mutation was performed using
primers described in Table 1. The reaction mixture for the latter experiment consisted of: 1 ␮g genomic DNA, 1⫻ Taq polymerase buffer (Life
Technologies, Inc., Gaithersburg, MD), 1.5 mm MgCl2, 0.2 mm dNTP, 1%
BSA, 20 pmol of each primer, 2.0 U Taq DNA polymerase (Life Technologies, Inc.) in a final volume of 30 ␮l. PCR steps were: 94 C for 5 min
(1 cycle); 12 cycles of 94 C for 1 min, a touchdown annealing step at 72– 65
C for 1 min (⫺0.5 C per step), 72 C for 1 min; 30 cycles of 94 C for 1 min,
65 C for 1 min, 72 C for 1 min; and a final cycle at 72 C for 5 min.
Results
In the present study, the 21-hydroxylase disease-causing
allele in a Brazilian girl with the classical form of 21-hydroxylase deficiency was analyzed.
Sequencing the entire CYP21 gene (10 exons and 9 introns,
655 nucleotides upstream to the transcription initiation
codon and 469 nucleotides downstream to the 3⬘ end) revealed one single sequence divergence when compared with
the CYP21 gene sequence published by Higashi et al. (19). The
insertion of one cytosine between nucleotides 82 and 83 in
exon 1 modified the second nucleotide of codon 28, which
normally codes for a histidine (Fig. 1A, left sequencing gel).
The insertion of a C at this position changes the amino acid
in codon 28 to a proline and causes a reading frame shift from
this point on leading to an in-frame stop codon at amino acid
78 (Fig. 1C). Sequencing gel showed the patient to be homozygous for the mutation. The patient’s mother is heterozygous for the mutation, because the sequencing gel
shows double bands for each nucleotide above the point of
the insertion, corresponding to the normal and the mutated
allele, which is one nucleotide longer (Fig. 1A, middle sequencing gel). The father tested normal (Fig. 1A, right sequencing gel). Because the father and the mother are firstdegree cousins, they should be carriers of the same mutation.
To verify the presence of H28⫹C in the disease-causing paternal allele, allele-specific primers for the normal and mutated sequences were designed (Table 1), and an ASO-PCR
was performed. The correct segregation of the mutation was
confirmed for the whole family (Fig. 1B), indicating the occurrence of an allele dropout either throughout the first
CYP21 selective PCR or throughout the sequencing procedures in the father-sequenced sample. Further support for
the father to be heterozygous other than normal homozygous
was given by the ASO-PCR analysis of the A/C656G most
frequent CYP21 mutation at nucleotide 656 in intron 2. This
experiment evaluates the occurrence of an A, C, or G nucleotide at the 656 position separately. The analysis of the family
showed that the father is heterozygous A/C, and both the
mother and the patient are homozygous C/C at this position
(Fig. 2). Therefore the C656 variant is associated with the
H28⫹C mutation, and this was not amplified in the A/C
heterozygous father. The C656 allele dropout in PCR procedures is not uncommon among A/C or G/C heterozygous
individuals (20).
Discussion
This paper describes the novel H28⫹C frameshift mutation found in a homozygous patient with the classical form
of 21-hydroxylase deficiency. No other sequence divergence
was found in the affected allele. A CYP21 gene PCR allelic
Lau et al. • Novel Mutation on CYP21-Affected Alleles
J Clin Endocrinol Metab, December 2001, 86(12):5877–5880 5879
FIG. 1. Direct sequencing analysis of CYP21 gene, showing the H28⫹C mutation. A, Part of the sequencing gel of the fragment amplified with
the primer pair 5⬘21B2-Ex3na and sequenced with primer Int1as, which reads the entire exon 1 sequence. Individuals are indicated on the top
of each set of sequencing lanes (G, A, T, C). The insertion of a C between nucleotides 82 and 83 is visualized in the homozygous affected patient
(left set of sequencing lanes) and the heterozygous mother (middle set), and it is not observed in the obligatory heterozygous father (right set).
The gel was loaded in the nucleotide order G, A, T, and C as indicated below the figure. B, Allele-specific PCR for the H28⫹C mutation: no.
1, father; no. 2, mother; no. 3, normal son; no. 4, affected daughter; no. 5, normal control. N, PCR for normal sequence; M, PCR for mutant
sequence. C, Normal and mutant sequence of CYP21 gene showing the insertion point, the reading frameshift, the amino acid changes, and
the creation of a stop codon at amino acid 78.
FIG. 2. ASO-PCR genotyping for A, C,
or G alleles at the nucleotide position
656. Figure shows the agarose gel for
the individuals of the family. Lane 1,
father; lane 2, mother; lane 3, affected
child; lanes 4, 5, and 6, positive controls.
Genotypes of each individual are indicated below the gel. Molecular weight
marker (M) is the 100-bp ladder (Life
Technologies, Inc.).
dropout artifact (20) was observed in the study of the family.
In genotyping all individuals of the family for the A/C3 G
nucleotide variation/mutation at the 656 position, it was
observed that the father is A/C, whereas the mother and the
affected child genotyped C/C (Fig. 2). Therefore, the H28⫹C
allele bears the 656C variant. Because the A/C heterozygous
father always seemed to be a normal homozygous for
H28⫹C mutation in the sequencing gel, it could be concluded
that in this case the 656C variant carrying the mutation was
never amplified when Ex6na-5⬘21B1s or Ex6na-Int2s primer
pairs were used for the CYP21 gene selective PCR performed
before the sequencing experiments. Thereafter, the mutation
segregation in the family could only be determined by ASOPCR for the H28⫹C mutation (Fig. 2B). Because nucleotides
A and G are purines and C is a pyrimidine, it seems that DNA
conformational effects cause the 656A or 656G-bearing CYP21
allele preferential amplification when the 656C allele is
present in the same genotype. A similar dropout effect is not
observed in the 656A/G genotypes, probably because both
nucleotides are purines. When the PCR was performed with
H28⫹C specific primer that anneals only in the 656C-bearing
allele, the dropout effect did not occur, and the carrier status
of the father was verified. The observation of dropout artifacts in this study confirms the data reported before by Day
et al. (20) and reinforces the idea that it is important to always
be aware of this common artifact when looking for sporadic
CYP21 mutations in families with CAH, especially in procedures that use a selective PCR for the region comprising
intron 2 prior sequencing.
The insertion of a C at the beginning of the gene sequence
within exon 1 alters the protein structure due to a reading
frameshift with the formation of a stop codon in position 78.
The resulting protein is completely inactivated because it has
50 amino acid changes in addition to the premature termination of translation at codon 78. This will produce a severely
truncated protein lacking most of the important residues for
the enzyme activity and stability (21, 22). The mutation was
not present in the published CYP21P sequence (19) (GenBank
5880
J Clin Endocrinol Metab, December 2001, 86(12):5877–5880
accession no. M12793). In addition, after an ASO-PCR screening, the H28⫹C mutation was not found in either CYP21
genes of any other patient or the genes of 20 normal controls.
Therefore, it consists of a rare allele found only in this family.
Several CYP21 rare missense mutations associated with
classical and nonclassical forms of the disease have been
described. However, there are only 11 cases of rare CYP21
frameshift mutations reported so far (1, 2). Of those, seven are
deletions, two are insertions, and two are combined insertion-deletions. The H28⫹C described here is the second
CYP21 insertional mutation found in exon 1. Ezquieta et al.
(23) described the W22⫹T mutation that consists of a T insertion between nucleotides 64 and 65. Both H28⫹C and
W22⫹T mutations cause the appearance of a stop codon at
amino acid 78.
Although the nucleotide insertion described here is different from the one reported by Ezquieta et al. (23), both
might produce similarly truncated proteins leading to severe
salt loss symptoms, once both mutations cause a stop codon
at the 78 amino acid position. Their patient was a homozygous boy presenting severe SW symptoms 10 d after birth
who, with continuous treatment, developed well. Our female
patient showed less severe clinical features. She did not experience clinical signs or symptoms of salt loss even after
discontinuing the treatment, except failure to thrive in her
second week of life. Certainly, the genital ambiguity at birth
led to an early diagnosis and treatment, which prevented SW
crises.
Another rare mutation, G424S, has been reported in several SV Brazilian patients (24). It was always associated with
C4A⫹CYP21P gene deletions and with the human leukocyte
antigen DR17 on the same haplotype, suggesting linkage
disequilibrium and representing a probable founder effect
for a rare affected allele. The H28⫹C mutation is the second
rare mutation to be reported in a patient with the classical
form of 21-hydroxylase deficiency in Brazil, and it seems to
be an isolated case because it was not found in any other SV
or SW patient.
Acknowledgments
We are grateful to Maria Madalena V. Rosa for technical assistance.
Received June 5, 2001. Accepted August 31, 2001.
Address all correspondence and requests for reprints to: Maricilda
Palandi de Mello, Ph.D., Centro de Biologia Molecular e Engenharia
Genética, Universidade Estadual de Campinas, Caixa Postal 6010, CEP
13083-970, Campinas, SP Brasil. E-mail: [email protected].
This work was supported by Fundação de Amparo à Pesquisa do
Estado de São Paulo, São Paulo, SP, Brasil, (proc. n° 97/07622-2). I.F.L.
received a personal grant from Fundação Coordenação de Aperfeiçoamento de Pessoal de Nı́vel Superior.
References
1. White PC, Speiser PW 2000 Congenital adrenal hyperplasia due to 21hydroxylase deficiency. Endocr Rev 21:245–291
Lau et al. • Novel Mutation on CYP21-Affected Alleles
2. Krawczak M, Cooper DN 1997 The human gene mutation database. Trends
Genet 13: 121–122
3. Nunez BS, Lobato MN, White PC, Meseguer A 1999 Functional analysis of
four CYP21 mutations from Spanish patients with congenital adrenal hyperplasia. Biochem Biophys Res Commun 262:635– 637
4. Krone N, Braun A, Roscher AA, Schwarz HP 1999 A novel frameshift mutation (141delT) in exon 1 of the 21-hydroxylase (CYP21) in a patient with the
salt wasting form of congenital adrenal hyperplasia. Hum Mutat 14:90 –91
5. Ohlsson G, Muller J, Skakkebaek NE, Schwartz M 1999 Steroid 21-hydroxylase deficiency: mutational spectrum in Denmark, three novel mutations, and
in vitro expression analysis. Hum Mutat 13:482– 486
6. Witchel SF, Smith R, Suda-Hartman M 1999 Identification of CYP21 mutations, one novel, by single strand conformational polymorphism (SSCP) analysis. Hum Mutat 13:172
7. Kirby-Keyser L, Porter CC, Donohoue PA 1997 E380D: a novel point mutation
of CYP21 in an HLA-homozygous patient with salt-losing congenital adrenal
hyperplasia due to 21-hydroxylase deficiency. Hum Mutat 9:181–182
8. Lajic S, Wedell A 1996 An intron 1 splice mutation and a nonsense mutation
(W23X) in CYP21 causing severe congenital adrenal hyperplasia. Hum Genet
98:182–184
9. Lee HH, Chao HT, Lee YJ, Shu SG, Chao MC, Kuo JM, Chung BC 1998
Identification of four novel mutations in the CYP21 gene in congenital adrenal
hyperplasia in the Chinese. Hum Genet 103:304 –310
10. Asanuma A, Ohura T, Ogawa E, Sato S, Igarashi Y, Matsubara Y, Iinuma K
1999 Molecular analysis of Japanese patients with steroid 21-hydroxylase deficiency. J Hum Genet 44:312–317
11. Wedell A, Luthman H 1993 Steroid 21-hydroxylase deficiency: two additional
mutations in salt-wasting disease and rapid screening of disease-causing mutations. Hum Mol Genet 2:499 –504
12. Wedell A, Ritzen EM, Haglund-Stengler B, Luthman H 1992 Steroid 21hydroxylase deficiency: three additional mutated alleles and establishment of
phenotype-genotype relationships of common mutations. Proc Natl Acad Sci
USA 89:7232–7236
13. Wedell A, Luthman H 1993 Steroid 21-hydroxylase deficiency: two additional
mutations in salt-wasting disease and rapid screening of disease-causing mutations. Hum Mol Genet 2: 499 –504
14. Lajic S, Levo A, Nikoshkov A, Lundberg Y, Partanen J, Wedell A 1997 A
cluster of missense mutations at Arg356 of human steroid 21-hydroxylase may
impair redox partner interaction. Hum Genet 99:704 –709
15. Wedell A, Luthman H 1993 Steroid 21-hydroxylase (P450c21): a new allele and
spread of mutations through the pseudogene. Hum Genet 91: 236 –240
16. Araujo M, Sanches MR, Suzuki LA, Guerra Jr G, Farah SB, De Mello MP 1996
Molecular analysis of CYP21 and C4 genes in Brazilian families with the
classical form of steroid 21-hydroxylase deficiency. Braz J Med Biol Res 29: 1–13
17. Paulino LC, De Araujo M, Guerra Jr G, Marini SHVL, De Mello MP 1999
Mutation distribution and CYP21/C4 locus variability in Brazilian families
with the classical form of the 21-hydroxylase deficiency. Acta Paediatr 88:
275–283
18. Wilson RC, Wei JQ, Cheng KC, Mercado AB, New MI 1995 Rapid deoxyribonucleic acid analysis by allele-specific polymerase chain reaction for detection of mutations in the steroid 21-hydroxylase gene. J Clin Endocrinol Metab
80:1635–1640
19. Higashi Y, Yoshioka H, Yamane M, Gotoh O, Fuji-Kuriyama Y 1986 Complete nucleotide sequence of 2 steroid 21-hydroxylase genes tandemly arranged in human chromosome: a pseudogene and a genuine gene. Proc Natl
Acad Sci USA 83:2841–2845
20. Day DJ, Speiser PW, Schulze E, Bettendorf M, Fitness J, Barany F, White PC
1996 Identification of non-amplifying CYP21 genes when using PCR-based
diagnosis of 21-hydroxylase deficiency in congenital adrenal hyperplasia
(CAH) affected pedigrees. Hum Mol Genet 5: 2039 –2048
21. Lewis DF, Lee-Robichaud P 1998 Molecular modelling of steroidogenic cytochromes P450 from families CYP11, CYP17, CYP19 and CYP21 based on the
CYP102 crystal structure. J Steroid Biochem Mol Biol 66:217–233
22. Nikoshkov A, Lajic S, Vlamis-Gardikas A, Tranebjaerg L, Holst M, Wedell
A, Luthman H 1998 Naturally occurring mutants of human steroid 21hydroxylase (P450c21) pinpoint residues important for enzyme activity and
stability. J Biol Chem 273: 6163– 6165
23. Ezquieta B, Oyarzabal M, Jariego CM, Varela JM, Chueca M 1999 A novel
frameshift mutation in the first exon of the 21-OH gene found in homozygosity
in an apparently nonconsanguineous family. Horm Res 51:135–141
24. Billerbeck AE, Bachega TA, Frazatto ET, Nishi MY, Goldberg AC, Marin ML,
Madureira G, Monte O, Arnhold IJ, Mendonca BB 1999 A novel missense
mutation, GLY424SER, in Brazilian patients with 21-hydroxylase deficiency.
J Clin Endocrinol Metab 84:2870 –2872