Download Regulation of KNOLLE syntaxin - Journal of Cell Science

RESEARCH ARTICLE
3001
Cell cycle-independent expression of the Arabidopsis
cytokinesis-specific syntaxin KNOLLE results in
mistargeting to the plasma membrane and is not
sufficient for cytokinesis
Axel Völker1, York-Dieter Stierhof2 and Gerd Jürgens1,*
1Zentrum
2Zentrum
für Molekularbiologie der Pflanzen, Entwicklungsgenetik, Universität Tübingen, Auf der Morgenstelle 1, D-72076 Tübingen, Germany
für Molekularbiologie der Pflanzen, Mikroskopie, Universität Tübingen, Auf der Morgenstelle 1, D-72076 Tübingen, Germany
*Author for correspondence (e-mail: [email protected])
Accepted 21 May 2001
Journal of Cell Science 114, 3001-3012 (2001) © The Company of Biologists Ltd
SUMMARY
The Arabidopsis KNOLLE gene encodes a cytokinesisspecific syntaxin that localises to the plane of division and
mediates cell-plate formation. KNOLLE mRNA and
protein expression is tightly regulated during the cell cycle.
To explore the significance of this regulation, we expressed
KNOLLE protein under the control of two constitutive
promoters, the flower-specific AP3 and the cauliflower
mosaic virus 35S promoter. The transgenic plants
developed normally, although KNOLLE mRNA and protein
accumulated to high levels in non-proliferating cells
and protein was incorporated into membranes.
Immunolocalisation studies in transgenic seedling roots
revealed mistargeting of KNOLLE protein to the plasma
membrane in tip-growing root hairs and in expanding root
INTRODUCTION
Cytokinesis partitions the cytoplasm of the dividing cell, which
requires targeting of membrane vesicles to the plane of
division. In yeast and animal cells, a contractile actomyosin
ring supports ingrowth of the existing plasma membrane, and
this cleavage furrow is expanded by the fusion of membrane
vesicles that are delivered along furrow microtubule arrays
(reviewed by Robinson and Spudich, 2000; Straight and Field,
2000). By contrast, plant cells form the partitioning plasma
membrane de novo from the centre to the periphery of the cell
(reviewed by Staehelin and Hepler, 1996; Heese et al., 1998).
Golgi-derived vesicles are transported along the microtubules
of a plant-specific cytoskeletal array, the phragmoplast, to the
plane of cell division where they fuse with one another to form
a transient membrane-bounded compartment, the cell plate,
which matures into a cell wall with flanking plasma
membranes. The lateral expansion of the cell plate is mediated
by the transformation of the phragmoplast from a compact
array into a widening hollow cylindrical structure that delivers
additional vesicles to the growing edge of the cell plate until
the latter fuses with the parental plasma membrane (Samuels
et al., 1995). Thus, plant cytokinesis is a special case of vesicle
trafficking and fusion.
Mutations in several genes of Arabidopsis, including
cells, whereas no mislocalisation was observed in
proliferating cells. By comparative in situ hybridisation to
embryo sections, the 35S promoter yielded, relative to the
endogenous KNOLLE promoter, low levels of KNOLLE
mRNA accumulation in proliferating cells that were
insufficient to rescue cytokinesis-defective knolle mutant
embryos. Our results suggest that in wild type, strong
expression of KNOLLE protein during M phase is
necessary to ensure efficient vesicle fusion during
cytokinesis.
Key words: Arabidopsis, Cytokinesis, Syntaxin, KNOLLE,
Expression
KNOLLE and KEULE, result in cytokinesis defects, such as
enlarged cells with incomplete cell walls and more than one
nucleus (Lukowitz et al., 1996; Assaad et al., 1996; Nacry et
al., 2000). KNOLLE encodes a cytokinesis-specific syntaxin
(Lukowitz et al., 1996; Lauber et al., 1997). KEULE is a
member of the Sec1 family of syntaxin-binding proteins that
interacts with KNOLLE in vitro and in vivo, and mutations in
both genes result in the accumulation of unfused cytokinetic
vesicles (Assaad et al., 2000; Lauber et al., 1997; Waizenegger
et al., 2000). Whereas the KEULE gene appears to be expressed
in both proliferating and non-proliferating cells (Assaad et al.,
2000), the expression of KNOLLE is tightly regulated during
the cell cycle. KNOLLE mRNA accumulates transiently in
proliferating cells, giving a patchy pattern that reflects
asynchrony of cell division in the embryo (Lukowitz et al.,
1996). KNOLLE protein accumulates only during M phase,
initially in patches presumed to represent Golgi stacks, then
localises to the forming cell plate during telophase and
disappears at the end of cytokinesis (Lauber et al., 1997). The
tight regulation of KNOLLE expression is reminiscent of the
synthesis and degradation of mitotic cyclins (Ito, 2000).
KNOLLE syntaxin appears to be involved in all sporophytic
cell divisions as well as in endosperm cellularisation (Lauber
et al., 1997).
Syntaxins are components of SNARE complexes that play
3002
JOURNAL OF CELL SCIENCE 114 (16)
an important role in membrane fusion events (reviewed by
Jahn and Südhof, 1999). The SNARE core complex consists
of three or four proteins that form a four-helix bundle: a
bipartite t-SNARE on the target membrane, which consists of
a syntaxin and a SNAP25 protein or two t-SNARE light-chain
proteins, interacts with the v-SNARE synaptobrevin on the
vesicle membrane (Clague and Herrmann, 2000). There are
numerous members of each SNARE protein family in yeast,
animals and plants that have been implicated in diverse vesicle
trafficking pathways between membrane compartments (for
reviews on plant SNAREs, see Blatt et al., 1999; Sanderfoot
et al., 2000). In general, syntaxins and synaptobrevins
involved in a particular pathway appear more closely related
to functional counterparts in different organisms than to
family members involved in a different pathway within the
same organism. The original SNARE hypothesis postulated
that specific pairs of cognate syntaxins and synaptobrevins
provide specificity to vesicle trafficking (Söllner et al., 1993a;
Söllner et al., 1993b). This idea was challenged in recent in
vitro interaction studies that provided evidence for
promiscuity among interacting SNARE partners (Fasshauer et
al., 1999). However, thorough analyses of yeast SNARE
interactions in liposome assays have indicated a high degree
of specificity of interaction between syntaxins and
synaptobrevins (Fukuda et al., 2000; McNew et al., 2000;
Parlati et al., 2000).
KNOLLE is a distant member of the plasma membrane
subgroup of the syntaxin family but has no close counterpart
among yeast or animal syntaxins (Lukowitz et al., 1996;
Sanderfoot et al., 2000). However, syntaxins with analogous
roles in membrane fusion during cellularisation or cytokinesis
have been described in animals. The Drosophila syntaxin 1
gene is required for cellularisation of the blastoderm embryo,
as well as for neural development (Burgess et al., 1997).
Likewise, the Caenorhabditis syn-4 gene is involved in
embryo cleavage divisions but also plays a role in nuclear
membrane reformation (Jantsch-Plunger and Glotzer, 1999).
In contrast to the other two syntaxins, KNOLLE is required
only for de novo formation of the partitioning plasma
membrane during cytokinesis, and its expression is tightly
regulated during the cell cycle, suggesting a unique role in
cytokinesis.
We have addressed the biological significance of the tight
regulation of KNOLLE expression by replacing the
endogenous 5′ regulatory region with promoters that are active
in both proliferating and non-proliferating cells. The
transgenic plants were phenotypically normal, although
KNOLLE protein accumulated strongly in non-proliferating
cells and was mistargeted to the plasma membrane.
Conversely, the KNOLLE transgene did not rescue knolle
mutant embryos, which correlated with low-level
accumulation of mRNA from the KNOLLE transgene in
proliferating embryonic tissue, when compared with the
activity of the endogenous KNOLLE gene. Our observations
suggest that the tight regulation of KNOLLE expression meets
two opposing requirements. First, the KNOLLE gene must be
strongly expressed to produce sufficient KNOLLE protein
during M phase for the efficient execution of cytokinetic
vesicle fusion. Second, degradation of KNOLLE mRNA and
protein prevents the accumulation of large quantities of
useless molecules.
MATERIALS AND METHODS
Plant material, growth conditions and in vitro culture
Arabidopsis thaliana ecotypes Wassilewskija (WS), Landsberg/
Niederzenz (Ler/Nd) heterozygous for the knolle mutation X37-2
(Lukowitz et al., 1996) and the EMS-induced knolle allele UU1319
(kindly provided by U. Mayer) were grown on soil at 18°C, as
described previously (Mayer et al., 1991). The Arabidopsis cell
suspension culture (Fuerst et al., 1996) was a gift from the John Innes
Centre (Norwich, UK). The in vitro culture was done in petri dishes
containing 1% Select Agar (Gibco BRL, Karlsruhe, Germany) and
0.5× or 1× Murashige and Skoog (MS) salts (Ducheva, Haarlem, The
Netherlands) at 18°C under constant illumination. To induce root hair
formation, 1% sucrose was added. To determine the organisation of
vacuoles in root hairs, seedlings were grown on 0.5× MS medium
containing no, 1% or 3% sucrose. Callus induction of knolle-X37-2
mutant seedlings carrying the 35S::KN transgene was carried out
with modified callus-inducing (1 mg/l 2.4D, 0.25 mg/l kinetin) or
shoot-inducing (0.5 mg/l NAA, 0.25 mg/l kinetin) media (Soni et al.,
1995).
Plant transformation and selection of transgenic plants
WS and knolle-X37-2 (Ler/Nd) heterozygous plants were transformed
by a modified transformation protocol (Bechtold and Pelletier, 1998;
Clough and Bent, 1998), using a combination of vacuum infiltration
and additional dip transformation one week later. One hundred to 150
plants were transformed with an Agrobacterium GV3101 culture
bearing the desired transgene. Infiltration medium consisted of 0.5×
MS salts, 1× Gamborg B5 vitamins (Ducheva), 5% sucrose, 0.044 µM
benzyl aminopurine (Sigma) pH 5.7 with KOH, and 0.005% SILWET
L77 (Osi Specialities). T1 seeds were bulk-harvested (each seed
representing a single transformation event; Bechtold et al., 2000;
Desfeux et al., 2000; Ye et al., 1999), sown on soil and selected for
transformants by spraying BASTA® (183 g/l Glufosinate, AgrEvo™;
Düsseldorf, Germany; 1:1000) twice. BASTA®-resistant plants were
genotyped for KNOLLE by PCR with the primers X37-2C and X372D (Lukowitz et al., 1996), which amplify a 0.7 kb fragment from
X37-2 and a 1.7 kb fragment from wild type. Seeds containing knolle
mutant embryos are shrunken and darker than wild-type seeds. For
confirmation of the genotype, mutant seeds were germinated on 0.5×
MS salts, 1% Select Agar plates, and seedlings were examined for the
knolle mutant phenotype.
Plants heterozygous for kn-X37-2 were transformed with the
KNRescue construct (see Fig. 1). Selfing of the T0 plants gave three
distinguishable genotypes of BASTA®-resistant T1 progeny bearing
the KN transgene: (1) KN/KN, (2) kn/KN and (3) kn/kn. PCR with
KNOLLE-specific primers amplified the kn-X37-2 fragment from the
genotypes (2) and (3) (Lukowitz et al., 1996). Selfing of T1 plants
with genotype (2) or (3) produced 6.25% or 25% knolle mutant T2
seeds, respectively. Reduction of phenotypically mutant seeds from
25% to 6.25% for genotype (2) indicated complementation. One-third
of the Basta-resistant T2 plants derived from genotype (3) were
homozygous for the transgene and produced only phenotypically
normal seeds, although the embryos were homozygous for the knX37-2 mutant allele (T3 generation).
Molecular biology
Constructs for plant transformation were introduced into pBar vectors.
pBarA (AJ251013) was used for AP3::KN misexpression and for the
rescue of the knolle mutant phenotype by a KNOLLE SacI-SnaI
genomic fragment. pBar-35S (AJ251014) was used for 35S::KN
misexpression. pBar vectors were a gift from G. Cardon (MPI,
Cologne, Germany). PCR was carried out according to standard
procedures using TaqPlus Precision™ (Stratagene, La Jolla, CA),
Expand High Fidelity™ (Roche Mannheim, Germany) and Taq DNA
Polymerase™ (Roche). The AP3 promoter fragment was amplified by
PCR using pD1075:AP3 (−650Æ −1, a gift from T. Jack) with the
Regulation of KNOLLE syntaxin
forward primer AP3-98a (5′AATTCTAGACAAGGATCTTTAGTTAAGGC 3) introducing a XbaI 5′ restriction site and with the reverse
primers AP3-46a (5′ATACTGCAGATTTGGTGGAGAGGACAAG
3′) and AP3-47: (5′ ATACTGCAGGAAGAGATTTGGTGGAGAGGACAAG 3′) introducing a consensus transcription start (Joshi, 1987)
and a 3′ Pst1 restriction site. The KNOLLE fragments KN1 (−217 to
+1500) and KN2 (−4 to +1500) were PCR amplified with either
forward primer KNstart1 (5′TTTCTGCAGCTTTCTCTCATCTCACA AATC 3′) or KNstart2 (5′ATACTGCAGAAGATGAACGACTTGATGACG 3′), introducing a PstI restriction site at the 5′ end, and
reverse primer KNstop (5′ATAGAATTCATGACCTTGTTCCAGAGATTG 3′), introducing an EcoRI cloning site at the 3′ end. AP3::KN1
(KNOLLE coding sequence with intron; see Fig. 1) and AP3::KN2
(coding sequence without intron) were used for KNOLLE
misexpression, which gave essentially the same results (data not
shown). XbaI-AP3::KN-EcoRI was cloned into pBarA. p35S::KN
constructs were obtained by restriction digest of Bluescript SK::KN2
with XhoI, introducing 40 nucleotides non-coding sequence 5′ to the
KNOLLE translational start. The 3′ end of the KN2 fragment was a
XbaI restriction site within the Bluescript SK vector, introducing
another 30 nucleotides. This fragment was cloned into pBar-35S SmaI
+ XbaI. A genomic SnaI and SacI 4.75 kb fragment containing
KNOLLE was directly subcloned into pBarA SacI, SmaI. The
constructs were confirmed by sequencing and transformed into
Agrobacterium tumefaciens strain GV3101 (GV3101 + pM90: gift
from G. Cardon, MPI Cologne, Germany). The p35S::KN transgene
was re-amplified from transgenic plants by using the forward primer
35SPromoter2 (5′ACGCACAATCCCACTATCCTT 3′) and the
reverse primer 35STerminator2 (5′AAGAACCCTAATTCCCTTATCTGG 3′) close to the multiple cloning site of pBar-35S, and
sequenced. The 35S::GUS reporter construct from the pBIC20 cosmid
vector (Meyer et al., 1994) was used to monitor 35S promoter activity
in embryos and seedlings. Molecular work was carried out according
to standard protocols (Sambrook et al., 1989). Restriction enzymes
were purchased from NEB (New England Biolabs, Hitchin, UK);
synthetic oligonucleotides were from ARK Scientific (Sigma,
Germany).
In situ hybridisation
Sample preparation and in situ hybridisation of KNOLLE antisense
riboprobes transcribed in vitro were carried out according to Mayer
et al. (Mayer et al., 1998), using a 300 bp KNOLLE fragment from
the 5′ end of the coding region (Lukowitz et al., 1996). Paraffinembedded material was cut into 8 µm sections for embryos and 12.517.5 µm for seedlings. Digoxigenin-labelled probes were detected
with Boehringer anti-Dig FAB (Roche) coupled to alkaline
phosphatase. Western Blue® alkaline phosphatase (Promega,
Madison, USA) colour reaction was carried out for 1-4 days. Samples
were mounted in 50% glycerol. Images were taken with a Zeiss
Axiophot (Carl Zeiss Inc., Thornwood, NY), using a Nikon Coolpix
990 digital camera with 3.34 Mio pixels.
Immunoblotting and whole-mount immunofluorescence
microscopy
Immunoblotting and immunolocalisation were as previously
described (Lauber et al., 1997; Steinmann et al., 1999). For
separation of proteins, 12 to 15% polyacrylamide SDS (Sigma) gels
were used. Protein extraction was achieved by grinding plant material
with sand and boiling in 1× Laemmli buffer, except for cell
fractionation experiments. Western analysis with rabbit antiKNOLLE antiserum was performed as previously described (Lauber
et al., 1997). Protein concentrations were estimated by Coomassie
Blue staining. Cell fractionation was done as previously described
(Lauber et al., 1997). S10 was the supernatant of a 10,000 g precentrifugation, S100 and P100 were the supernatant and the pellet of
a 100,000 g centrifugation for 12 hours. Integral membrane proteins
were solubilised with Triton X-100 (Sigma; Lauber et al., 1997).
3003
Fig. 1. Constructs for KNOLLE expression in transgenic plants. The
constructs were cloned into the multiple cloning site of the pBar
transformation vectors indicated (see Materials and Methods).
Numbers indicate distances (in bp) from ATG (+1) of the KNOLLE
gene. The arrow above the gene indicates the orientation of
transcription. KNRescue (top), genomic DNA fragment containing
the KNOLLE gene and fragments of the adjacent genes. Thiored.,
gene encoding thioredoxin-1-like protein (AF144387); VI,
hypothetical gene possibly encoding a protein similar to violaxanthin
de-epoxidase (CAB59211.1); AP3::KN1 (middle), AP3 promoter
(pAP3) fused to a genomic DNA fragment with KNOLLE intron;
p35S::KN (bottom), CaMV 35S promoter (p35S) of the pBAR-35S
vector fused to a genomic DNA fragment without KNOLLE intron.
Restriction sites: E, EcoRI; P, PstI; Sc, SacI; Sn, SnaI; X, XbaI.
polyA, poly-adenylation site; L, left border of the T-DNA; R, right
border of the T-DNA.
Protein concentration was measured using a Bradford assay,
and equal amounts of protein were loaded onto the gel.
Immunolocalisation was carried out with rabbit anti-KNOLLE
antiserum diluted 1:2,000 or with mouse monoclonal anti-plasma
membrane H+-ATPase antibody diluted 1:500. Root tissue was fixed
with 4% paraformaldehyde (Sigma) in MTSB (pH 7.0) for 0.5 hours.
Goat anti-rabbit secondary antibody was coupled to Cy3™ (Dianova,
Hamburg, Germany) or Alexa-m488 (Molecular Probes, Eugene OR,
USA), goat anti-mouse secondary antibody was coupled to Cy3
(Dianova). Instead of MTSB, PBS (pH 7.2) was used in all steps after
fixation of the plant material. The primary antibody was incubated
for 3 hours at 37°C after blocking for 1 hour with 1% BSA in PBS,
the secondary antibody was incubated for 3 hours at 37°C. Nuclei
were stained with 1 mg/ml DAPI. After mounting in Citifluor (Agar,
Amersham), specimens were analysed with a Zeiss Axiophot
epifluorescence microscope equipped with a Nikon Digital camera
(3.34 Mio pixels) or with a Leica confocal laser scanning microscope
(CLSM) with Leica TCS-NT software. The CLSM standard objective
was 63× (water immersion), scanning was carried out with electronic
magnification.
Histochemical GUS staining
GUS staining was as previously described (Sundaresan et al., 1995).
Plant tissue was incubated in the detection solution (500 mM NaPO4
buffer pH 7.0, 500 mM EDTA pH 8.0, 150 mM potassium
ferrocyanide (K4Fe(CN)6 3H2O), 5% Triton X100, 40 mM X-Gluc in
dimethylformamide) in the dark at 37°C for several hours until the
blue colour became apparent. After transfer to water, the stained tissue
was examined by bright-field light microscopy.
3004
JOURNAL OF CELL SCIENCE 114 (16)
Fig. 2. Protein blots of extracts from KNOLLE transgenic plants.
Protein extracts were separated by SDS-PAGE and analysed by
immunoblotting with anti-KN antiserum (see Materials and
Methods). (A) Misexpression of KNOLLE from the flower-specific
AP3 promoter. Lanes 1-4: total protein extracts of wild-type (wt)
flowers (lane 1) and AP3::KN1 transgenic petals (lanes 2-4). Lanes
5-7: cell fractionation of pooled extracts (lanes 2-4). (B) Organ
distribution of KNOLLE protein misexpressed from the CaMV 35S
promoter. 35S, T3 transgenic plants homozygous for 35S::KN; wt,
wild-type control. (C) Quantitative analysis of KNOLLE expression
in 20 days old seedlings grown on different media. Lanes 1-3: 0.5×
MS salts with 0%, 1%, 3% sucrose. Lanes 4-6: 1× MS salts with 0%,
1%, 3% sucrose. Upper panel: similar amounts of total protein were
loaded. Lower panel: 35S::KN samples 1 and 3 were diluted 1:100
and 1:500; wild-type (wt) samples 2, 3 and 5 were not diluted.
(D) Membrane integration properties of KNOLLE protein from T3
generation plants homozygous for the 35S::KN transgene. Protein
extracts from leaves of 35S::KN plants (35S, top) or from flowers
and siliques of wild-type control (wt, middle) were differentially
centrifuged. The P100 fraction (lane 3) was resuspended with or
without Triton X-100 followed by a second 100,000 g centrifugation
(lanes 4-7). Plants heterozygous for the knolle mutant allele UU1319
(bottom) express normal KN protein (arrow) and a truncated KN
protein without the membrane anchor that was not pelleted by
100,000 g centrifugation (arrowhead). Arrow: position of the 34 kDa
KN protein; S10, supernatant of 10,000 g centrifugation; S100,
supernatant; P100, pellet of 100,000 g centrifugation.
Staining of root hair membranes with fluorescent dyes
FM4-64 and FM1-43
Wild-type and transgenic seedlings grown on agar plates were stained
with the lipophilic steryl-dyes FM4-64 and FM1-43 (1 mg/mL;
Molecular Probes, Eugene OR, USA). Both dyes show a Stoke shift
when integrated into membranes, depending on the membrane
composition. Whole seedlings were stained alive or after fixation with
4% paraformaldehyde (in MTSB) for 5 minutes and then destained
for 15 minutes in water. For confocal laser scanning microscopy,
FM4-64 and FM1-43 were excited by the laser at 568 nm and 488
nm, respectively, and emitted light at >600 nm and 500-530 nm plus
580-630 nm. In live root hair cells, FM4-64 stains predominantly
endomembranes and also the plasma membrane, whereas the less
hydrophobic dye FM1-43 preferentially stains the plasma membrane.
FM4-64 endomembrane labelling correlated with the number and size
of vacuolar structures in root hairs grown on 0.5× MS medium by
varying sucrose content: increasing sucrose concentration (0% to 3%)
resulted in enlarged but fewer vacuoles.
Immunolocalisation on cryosections and EM analysis
Roots of 5-day-old plants grown on 0.5× MS salts, 1% sucrose and 1%
Select Agar were fixed with 4% formaldehyde in MTSB (pH 7.0) for
60 minutes and embedded in 1% agarose. After infiltration with 20%
(w/v) polyvinylpyrrolidone (MW 10,000, PVP-10; Sigma) in 1.8 M
sucrose (Tokuyasu, 1989) and freezing in liquid nitrogen, cells were
sectioned at –85°C (400 nm, semithin) or at –100°C (100 nm, ultrathin)
with a Leica Ultracut S/FCS. Cryosections were transferred to poly-Llysine-coated (Sigma) coverslips for immunofluorescence or collected
on electron microscopy copper grids. After blocking (1% skim
milk/0.5% BSA in PBS, pH 7.2), labelling with rabbit anti-KNOLLE
antiserum (1:1000) was performed for 60 minutes followed by
incubation with Cy3-conjugated goat anti-rabbit secondary antibody
(Dianova) or protein A-15 nm gold for 60 minutes (Slot and Geuze,
1985). For immunofluorescence, sections were stained with DAPI and
embedded in Mowiol 4.88 (Hoechst, Frankfurt/Main, Germany;
Rodriguez and Deinhardt, 1960) containing DABCO (25 mg/ml;
Sigma; Langanger et al., 1983). For electron microscopy, grids were
stained with uranyl acetate and embedded in methyl cellulose (Sigma)
according to Griffiths (Griffiths, 1993). Cy3-labeled cryosections were
viewed with a Zeiss Axioplan, gold-labelled cryosections with a
Philips 201 electron microscope at 60 kV accelerating voltage. For
ultrastructural analysis, 5-day-old roots were cryofixed in liquid
propane, freeze-substituted in acetone containing 0.5% glutaraldehyde
and 0.5% osmium tetroxide and embedded in Spurr. Ultrathin sections
were stained with uranyl acetate and lead citrate.
Processing of digital pictures
All images shown were processed with Photoshop 5.0 and Illustrator
8.0 (Adobe Mountain View, CA).
RESULTS
Ectopic expression of KNOLLE protein has no
phenotypic effect
Because of the tight regulation of KNOLLE expression in
Regulation of KNOLLE syntaxin
3005
Fig. 3. KNOLLE protein immunolocalisation in 35S::KN seedling
roots. Seedlings were grown on 1% agar with 0.5× MS salts and 1%
sucrose. Dark-field images of wild-type root tip (B) and root
differentiation zone (E) are shown as reference for the
epifluorescence images of roots homozygous for the 35S::KN
transgene (A,D,G) and of wild-type control roots (C,F,H). Broken
lines delineate root tips (A,C) and root hairs and lateral surface of
root (D,F). (A,C) Root tip with KN-labelled cell plates (arrowheads).
KN is also expressed in the non- proliferating cells of the central
cylinder in the transgenic root (A; see also D) but not in the wildtype root (C). (D,G,F,H) Differentiation zone of the root. KN is
expressed in the central cylinder (cr) and in root hair tips
(arrowheads) of transgenic roots (D,G) but not in wild-type control
roots (F,H). (D,F) Brightness of images increased; (F) maximum
brightness to visualise the wild-type root in the absence of the KN
signal. (G,H) Original images; (H) wild-type root is not visible. (IL) GUS staining (2 hours, blue colour) to visualise 35S promoter
activity in 6-day-old 35S::GUS transgenic seedlings. (I) Seedling
with high GUS activity in root tip, root hairs and tips of the
cotyledons. Boxed areas are magnified in J (young root hair), K
(central part of the root) and L (root tip). Scale bar: 50 µm.
proliferating cells, we considered the possibility that its
deregulated expression might be deleterious, as has been
shown for other cell cycle-regulated genes (Ito, 2000) and
syntaxins (Zhou et al., 2000). We therefore generated
transgenic plants that expressed KNOLLE protein under the
control of the flower-specific APETALA3 (AP3) promoter (Fig.
1; AP3::KN1). The AP3 promoter is active in the petal and
stamen primordia of the flower (Jack et al., 1992; Jack et al.,
1994). If misexpression of KNOLLE interfered with cellular
or developmental processes, this would be recognised by floral
abnormalities of viable transgenic plants. Surprisingly, the
transgenic plants were morphologically normal, although
KNOLLE protein accumulated to high levels in petals (Fig.
2A). In addition, KNOLLE protein was detected in the
microsomal fraction (Fig. 2A), as described for endogenous
KNOLLE, an integral membrane protein (Lauber et al., 1997;
see Fig. 2D). To determine possible effects of excessive
amounts of KNOLLE protein in other organs and
developmental stages, we generated 35S::KN transgenic plants
(Fig. 1; Benfey et al., 1989). The 35S::KN transgenic plants
were also morphologically normal, although misexpressed
KNOLLE protein was detected at very high levels in protein
extracts from mature leaves and stem, both of which consist of
differentiated cells that normally contain no KNOLLE protein
(Fig. 2B). By semi-quantitative analysis of protein extracts,
35S::KN transgenic seedlings contained at least 100-fold more
KNOLLE protein than did wild-type seedlings (Fig. 2C).
Furthermore, in leaves of 35S::KN plants, KNOLLE protein
was localised to the membrane fraction from which it could be
removed by Triton-X100 (Fig. 2D), as reported for endogenous
KNOLLE protein (Lauber et al., 1997). This subcellular
localisation indicated that the membrane anchor of
misexpressed KNOLLE protein was functional. For
comparison, truncated KNOLLE protein from the knolle allele
UU1319 that shows the complete loss-of-function phenotype
lacks the membrane anchor and was detected in the soluble
fraction (Fig. 2D; see Materials and Methods). In summary,
misexpression from two different promoters resulted in highlevel accumulation of membrane-integrated KNOLLE protein
in non-proliferating cells, but did not interfere with essential
cellular or developmental processes. Because it had no
deleterious effect, misexpression of KNOLLE offered the
unique possibility of exploring how the cell deals with a
syntaxin that cannot be trafficked to its proper destination,
which in this case is the cell plate.
Mistargeting of KNOLLE protein in 35S::KN
transgenic seedling roots
To determine the fate of misexpressed KNOLLE protein,
35S::KN transgenic embryos and seedlings were analysed by
whole-mount immunolocalisation. Whereas no distinct pattern
of abnormal localisation was detected in embryos (data not
shown), deviation from the wild-type pattern was observed in
roots of transgenic seedlings carrying two copies of the
35S::KN transgene outside the meristematic region of the root
3006
JOURNAL OF CELL SCIENCE 114 (16)
Fig. 4. KNOLLE protein
immunolocalisation in developing root
hairs of 35S::KN seedlings. Seedlings
were grown on 1% agar with 0.5× MS
salts and 1% sucrose. (A) Dark-field,
(B) epifluorescence microscopy,
(C-Q) optical sections, confocal laserscanning microscopy; n, nucleus; pm,
plasma membrane. (A-M,O-Q) 35S::KN,
(N) wild-type control. (B,C,EG,N) Anti-KN antiserum (Cy3, red) and
DAPI (blue) staining. (D,H-M) Double
labelling with anti-KN antiserum
(Alexa-m488, green) and anti-PMATPase monoclonal antibody (Cy3, red)
and DAPI (blue) staining.
(O-Q) Membrane labelling of live
seedling roots with lipophilic dye FM464. The surface of root hairs and the
root is delineated by broken lines in
(E-G,K-O,Q). (A-D) Overviews.
(A) Seedling root with root hairs of
increasing age. (B-D) KN accumulation
in root hairs: (B) young root hair tip
(boxed) of similar age as those in
(E,H-J); (C) old root hairs; boxed area is
enlarged in G and similar region is
shown in Q; (D) old root hairs; boxed
area is shown in (K-M). Surface of root
hairs is delineated by white lines in
(C,D). (E-G) KN accumulation in
young (E), mid-age (F) and old (G)
transgenic root hairs. (H-M) Colocalisation of KN and PM-ATPase in
young (H-J) and old (K-M) root hairs.
(H,K) KN staining, (I,L) PM-ATPase
staining, (J,M) overlays; pink colour in
J is due to additional DAPI nuclear
signal. Note co-localisation of the two
antigens in old root hair (K-M), which
is partly collapsed owing to fixationinduced plasmolysis. (N) Young root
hairs of wild-type control showing no
KN signal; compare with B,E.
(O-Q) Endomembrane staining of young (O), mid-age (P) and old (Q) root hairs. Compare (O,P) with strong KN accumulation in root hair tips
(E,H) filled by vesicles, ER and Golgi (see Fig. 5K,L). In old root hairs (Q), FM4-64 staining resembles the KN staining (C,G).
tip (Fig. 3). A clear difference between 35S::KN and wild-type
roots was noted in the cells of the adjacent elongation zone and
in the more mature part of the root, but not in the root tip, where
cell divisions take place. The expanding cells of the central
cylinder and the tip-growing root hairs strongly accumulated
KNOLLE protein in transgenic, but not in wild-type seedlings
(compare Fig. 3D,G with Fig. 3F,H). The activity of the 35S
promoter was independently monitored by the expression of a
GUS reporter gene (Fig. 3I-L). GUS staining was observed in
root hairs, the central part of the root and the root tip, as
described previously for the tobacco seedling root (Benfey et
al., 1989). Although the 35S promoter was active in the
proliferating cells of the root tip, KNOLLE protein failed to
accumulate to high levels, presumably owing to cell cycledependent degradation. In summary, KNOLLE protein
expressed from the transgene accumulated in root cells that
were no longer dividing.
The subcellular localisation of misexpressed KNOLLE
protein was analysed in detail in readily accessible root hair
cells by confocal laser scanning microscopy (Fig. 4). These
non-proliferating epidermal cells form a local outgrowth, the
root hair, which undergoes tip growth by targeting membrane
vesicles from the trans-Golgi to the apical plasma membrane
(for a review, see Yang, 1999; see also Fig. 5J,K). In a sense,
this preferential vesicle targeting to the growing tip of the root
hair resembles the vesicle targeting to the cell division plane
during cytokinesis. Growing and mature root hairs were
immunostained with anti-KNOLLE antiserum and with a
monoclonal antibody directed against the plasma membrane
H+-ATPase (PM-ATPase; Lauber et al., 1997). KNOLLE
protein accumulated strongly in growing and mature root hairs
of transgenic seedlings, in contrast to the wild-type control
(Fig. 4B-D,E-G; compare with Fig. 4N). In young root hairs,
KNOLLE was concentrated at the tip (Fig. 4B,E,H), whereas
older root hairs also accumulated KNOLLE away from the tip
(Fig. 4C-D,F,G,K). For comparison, we used the lipophilic
Regulation of KNOLLE syntaxin
3007
Fig. 5. Subcellular
immunolocalisation of
KNOLLE protein in root cells
of 35S::KN seedlings.
(A-C) Confocal laser-scanning
microscopy of dividing cells in
wild-type root tip stained for
KN (Cy3, red) and DAPI (false
colour, green) to show the
temporal and spatial dynamics
of KN relocalisation during
cytokinesis; cells are delineated
by broken lines. (A) Prophase:
KN patches, presumably Golgi.
(B) Telophase: KN in plane of
cell division and nearby patches.
(C) Late phase of cytokinesis:
KN-positive cell plate extends to
the parental cell wall, only few
patches remain. (D-L) 35S::KN
transgenic root cells.
(D-F) Semi-thick cryo-sections
through the central cylinder of
root. (D,E) Cross section:
(D) KN immunofluorescence;
(E) phase contrast of D; cells
close to the phloem show strong
signals (D) at the cell surface
and inside the cells (asterisks,
D; arrowheads, E) point to the
xylem. (F) KN
immunofluorescence of
longitudinal section: the plasma
membrane (arrowhead, pm) and
Golgi-like intracellular
structures (arrow, g) are
labelled. (G-I,L) Ultrathin cryo
sections of root (G-I) and root
hair (L) labelled with anti-KN
immunogold. Cryo sections
were required because the antiKNOLLE antiserum does not
detect the integral membrane
protein KNOLLE on
conventional EM sections after
chemical fixation (Lauber et al.,
1997). Cryosections do not
preserve membrane structures
very well. (G) Root cell adjacent
to xylem cell (overview). Gold
labelling within areas delineated
by dashed or dotted lines is highlighted by yellow (internal staining) or red (plasma membrane) asterisks to visualise gold label that is not
readily detectable at this low magnification. g, Golgi; m, mitochondrion; pm, plasma membrane. (H) Higher magnification of upper boxed area
in G rotated 90° clockwise showing KN immunogold label at the plasma membrane (pm), Golgi (g) and post-Golgi area. m, mitochondrion.
(I) KN immunogold labelling of Golgi (g) and trans-Golgi (t) compartments. (J,K) Ultrathin section of chemically fixed and embedded root
hair. (K) Higher magnification of boxed area in J: root hair tip filled with rough endoplasmic reticulum (er) and numerous electron-dense
vesicles (v). (L) Strongly KN-labelled vesicles (v) and trans-Golgi network (t) from root hair tip. Scale bar: 20 µm in D-F; 250 nm in H,I,K,L.
fluorescent dye, FM4-64, which labels predominantly the
membrane of the vacuole in yeast (Vida and Emr, 1995). In
root hairs, FM4-64 labelled predominantly endomembranes
and to some extent the plasma membrane (Fig. 4O). Most of
the FM4-64 label was located below the KNOLLE-positive
apical region in young root hairs (compare Fig. 4P with 4E).
In older root hairs, however, the FM4-64 label resembled
KNOLLE-positive aggregates (Fig. 4P,Q; compare with Fig.
4F,G). To determine the fate of misexpressed KNOLLE protein
more precisely, root hairs of 35S::KN seedlings were
simultaneously immunostained for PM-ATPase (Fig. 4H-M).
In young root hairs, both proteins co-localised to the apical tip
region, not only at the surface but also internally (Fig. 4E-G;
additional optical sections not shown). Away from the tip
3008
JOURNAL OF CELL SCIENCE 114 (16)
Fig. 6. KNOLLE protein expression in a kn-X37-2 mutant seedling
carrying the 35S::KN transgene. (A) Cartoon of knolle mutant
seedling. Boxed area is shown in B. (B) Root hairs stained for
KNOLLE protein (green) and nuclei (DAPI, blue). Arrows indicate
KNOLLE protein accumulation in root hair tips.
region, both proteins were strictly localised to the surface,
resembling the plasma membrane staining with the lipophilic
fluorescent dye, FM1-43 (data not shown; see Materials and
Methods). Older root hairs also displayed almost perfect colocalisation of KNOLLE and PM-ATPase (Fig. 4K-M). Thus,
KNOLLE protein was targeted like a protein destined to the
apical plasma membrane of the growing root hair.
To reveal the ultrastructural localisation of KNOLLE protein
in non-proliferating cells of 35S::KN transgenic seedlings, root
cryosections were prepared for immunogold-labelling electron
microscopy (Fig. 5; see Materials and Methods). In the central
cylinder of the root, expanding cells displayed cytoplasmic
patches of KNOLLE immunofluorescence that resembled
those in dividing cells (Fig. 5D,F; compare with Fig. 5A).
However, KNOLLE was also located at the plasma membrane,
whereas dividing cells accumulated KNOLLE in the forming
cell plate (Fig. 5F, arrowhead; compare with Fig. 5B,C). By
immunogold labelling, KNOLLE was detected in Golgi stacks,
the trans-Golgi network and at the plasma membrane of
expanding root cells (Fig. 5G-I). We also analysed tip-growing
young root hairs, which accumulate vesicles underneath the
apical plasma membrane (Fig. 5J,K; Galway et al., 1997). AntiKNOLLE immunogold label was concentrated at the tip of the
root hair, with vesicles giving the strongest signal (Fig. 5L). In
summary, these data support the light microscopy observation
that KNOLLE protein is mistargeted to the plasma membrane
in non-proliferating cells of 35S::KN transgenic plants. In
addition, this is the first time that KNOLLE protein has been
localised in cells at the ultrastructural level.
No rescue of knolle mutant embryos by 35S::KN
transgene expression
Expression of the 35S::KN transgene lacked any detectable
biological effect in the wild-type genetic background. We
therefore examined whether the transgene could functionally
replace the endogenous KNOLLE gene. We transformed plants
heterozygous for the kn-X37-2 mutation (Lukowitz et al.,
1996) with the 35S::KN transgene and analysed their progeny
for the occurrence of mutant seeds. As a control, we
transformed kn-X37-2/KN heterozygous plants with a genomic
DNA fragment that differed from the 35S::KN transgene in
the 5′ region, whereas their 3′ regions were nearly identical
(see Fig. 1). The control construct gave 22 kn-X37-2/KN
heterozygous and 13 kn-X37-2/knX37-2 homozygous
independent transformants, all of which produced viable and
fertile kn-X37-2/knX37-2 homozygous plants (for details, see
Materials and Methods). By contrast, none of the 18 kn-X372/KN heterozygous independent transformants bearing the
35S::KN transgene gave rise to kn-X37-2/knX37-2
homozygous plants. Thus, the 35S::KN transgene did not
rescue kn-X37-2 mutant embryos. The transgene also did not
promote growth of kn-X37-2 mutant seedlings on callusinducing medium (data not shown, see Materials and
Methods). Sequencing of the transgene after re-isolation from
the transgenic plants did not show any deviation from the
wild-type sequence (see Materials and Methods). We therefore
checked kn-X37-2 mutant seedlings carrying the 35S::KN
transgene for KNOLLE protein accumulation by whole-mount
immunolocalisation (Fig. 6). KNOLLE protein was detected
in root hair cells of those knolle mutant seedlings. Thus, the
35S::KN transgene produced KNOLLE protein in knolle
mutants, but failed to rescue cytokinesis-defective kn-X37-2
mutant embryos and seedlings.
Low-level accumulation of KNOLLE mRNA
transcribed from the 35S promoter in the embryo
To determine why 35S::KN did not rescue the knolle mutant
phenotype, although transgenic plants expressed high levels of
KNOLLE protein (see Fig. 2B,C), we analysed the transcript
accumulation by in situ hybridisation of a KNOLLE antisense
riboprobe to sections of 35S::KN transgenic embryos that
carried two functional copies of the endogenous KNOLLE gene
(Fig. 7). Up to the torpedo stage of embryogenesis, KN mRNA
accumulated in a patchy pattern that was indistinguishable
from the wild-type control (Fig. 7A,B; Lukowitz et al., 1996).
At the bent-cotyledon stage, transgenic embryos showed
diffuse expression predominantly in the cotyledonary
primordia, whereas only a few cells in the wild-type control
embryos were labelled (compare Fig. 7D,E,G with Fig. 7C).
The intensity of diffuse staining was stronger in embryos with
two copies of the transgene than in those with only one,
indicating that the staining was due to transgene expression
(compare Fig. 7E,G with Fig. 7D). Transgene expression was
strongest in presumptive vascular cells of the cotyledons (Fig.
7E,F) and in adjacent internal cell layers (Fig. 7G,H). Within
these stained tissues, individual cells gave stronger signals that
resembled in intensity the stained cells in the hypocotyl, and
probably reflect the expression of the endogenous KNOLLE
gene (Fig. 7H, arrowheads). In summary, mRNA transcribed
from the 35S::KN transgene accumulated detectably only at
advanced stages of embryogenesis, at which its level of
accumulation was lower than that of the endogenous KNOLLE
mRNA. This result was consistent with the observation that
developing 35S::GUS embryos showed comparable temporal
and spatial distribution and intensity of GUS expression (data
not shown), and that KNOLLE protein immunolocalisation did
not reveal any difference between 35S::KN transgenic and
wild-type embryos.
35S::KN transgene expression in the seedling root
To compare KNOLLE mRNA accumulation from 35S::KN
transgene expression with the immunolocalisation of
misexpressed KNOLLE protein, we examined seedling roots
by in situ hybridisation. Unlike the situation in the embryo,
most cells of the seedling are mitotically inactive. Exceptions
Regulation of KNOLLE syntaxin
3009
Fig. 7. KNOLLE mRNA expression pattern in 35S::KN transgenic embryos and seedlings. In situ analysis using KN antisense probe. Embryos 8
µm, seedlings 17.5 µm sections. Unless stated otherwise, 35S::KN material is homozygous for the transgene. (A-H) embryos, (I-U) seedlings.
(A) Wild-type, torpedo-stage embryo. (B) 35S::KN, torpedo-stage embryo. (C) Wild-type, bent-cotyledon stage embryo. (D) 35S::KN, bentcotyledon stage embryo carrying only one copy of the transgene. Note slight KNOLLE mRNA overexpression in cotyledons. (E-H) 35S::KN,
bent-cotyledon stage embryo. KNOLLE mRNA is overexpressed in cotyledons. (E) Overview; (F) higher magnification of area boxed in E –
expression in pre-vasculature of cotyledon (arrowheads). (G) Overview; (H) higher magnification of area boxed in G – arrowheads indicate
cells with stronger signals resembling the patchy mRNA pattern observed in wild type. (I) Wild-type, root with root hairs. (J) 35S::KN, root
with root hair. KN mRNA is accumulated in central part of the root. (K) 35S::KN, lateral root primordium with strongly labelled cells
(asterisks) and young root hair (arrowhead) show mRNA accumulation. cot, cotyledon. Scale bars: 50 µm.
are the meristems of the shoot and the root as well as the
primordia of leaves and lateral roots. The mature root of wildtype seedlings showed little or no distinct staining (Fig. 7I). By
contrast, the root of transgenic seedlings gave strong signals in
the expanding central cells (Fig. 7J) and also in tip-growing
root hairs (Fig. 7K). These observations were consistent with
the immunolocalisation of KNOLLE protein in transgenic
roots and with the 35S::GUS expression pattern (see Fig. 3).
In addition, strong expression of the 35S::KN transgene was
observed in lateral root primordia (Fig. 7K), with patches of
dark staining above a lighter background, resembling the
situation in embryogenesis. Thus, the activity of the 35S::KN
transgene yielded high levels of KNOLLE mRNA mainly in
non-proliferating cells that did not express the endogenous
KNOLLE gene.
DISCUSSION
Consistent with its role as a cytokinesis-specific syntaxin,
Arabidopsis KNOLLE protein accumulates during M phase,
relocates to the plane of cell division during telophase and
disappears at the end of cytokinesis (Lauber et al., 1997). The
transient accumulation of KNOLLE protein closely follows
that of KNOLLE mRNA (Lukowitz et al., 1996), suggesting
that synthesis and degradation of both mRNA and protein are
regulated in a cell cycle-dependent manner. We have addressed
the biological significance of this tight regulation.
KNOLLE protein targeting depends on the cell cycle
By expressing KNOLLE in non-proliferating cells, we created
an abnormal situation in which vesicles budding from the
3010
JOURNAL OF CELL SCIENCE 114 (16)
trans-Golgi could deliver KNOLLE to several potential target
membranes. However, KNOLLE co-localised with the plasma
membrane H+-ATPase in tip-growing root hairs, thus behaving
like an integral plasma membrane protein. This result was
confirmed by ultrastructural immunolocalisation of KNOLLE
protein not only in root hairs but also in expanding cells of the
central cylinder of the root. Thus, the plasma membrane
appears to be the destination of KNOLLE protein in nonproliferating cells.
Mistargeting of KNOLLE to the plasma membrane did not
interfere with essential cellular processes that are required
for normal plant development. Tip-growing root hairs
were morphologically indistinguishable between 35S::KN
transgenic and wild-type plants, although only the former
accumulated large amounts of KNOLLE protein in the apical
growth zone. This observation suggests that KNOLLE did not
obviously interfere with the interaction of SNARE complex
partners involved in apical membrane fusion, which would be
consistent with recent findings of yeast SNARE pairing
specificity (McNew et al., 2000). Although we cannot rule out
the fact that KNOLLE interacts with non-cognate SNARE
partners without obvious deleterious effects, it is also
conceivable that in non-proliferating cells, KNOLLE might be
a biologically inactive passenger protein on vesicles destined
to the plasma membrane.
Why does KNOLLE traffic to the plasma membrane in nonproliferating cells? As eukaryotic cells express several
syntaxins, each of which resides in a distinct membrane
compartment, there must be a sorting mechanism to ensure that
each syntaxin is delivered to its proper destination. For
example, the Arabidopsis syntaxin AtPEP12 is targeted to the
vacuolar pathway (da Silva Conceicao et al., 1997). Although
the mechanism of syntaxin sorting is unknown in plants, recent
observations suggest that sorting occurs during vesicle budding
from the trans-Golgi donor membrane in yeast. An acidic dileucine motif of the vacuolar t-SNARE Vamp3p appears
essential for sorting mediated by the adaptor protein complex
AP-3 (Darsow et al., 1998), whereas Golgi-associated coat
proteins with homology to gamma adaptin appear to interact
with a different sorting motif of Pep12p for its targeting to late
endosomes (Black and Pelham, 2000). By contrast, no AP3dependent sorting motif has been identified in the plasma
membrane syntaxins, Sso1 and Sso2 (Tang and Hong, 1999),
and KNOLLE lacks the consensus acidic di-leucine motif. If
post-Golgi trafficking to the plasma membrane were a default
pathway in the absence of specific targeting cues, mistargeting
of KNOLLE protein might reflect the lack of such a sorting
signal. This does not exclude the possibility that normal
targeting of KNOLLE to the plane of cell division may involve
a hypothetical sorting-signal receptor that is not present in nonproliferating cells. The existence of an active sorting
mechanism for proteins destined to the cell plate has been
hypothesised based on the behaviour of GFP-KOR, a
GFP fusion to the Arabidopsis endo-1,4-β-D-glucanase
KORRIGAN (Nicol et al., 1998), in a heterologous expression
system (Zuo et al., 2000). KORRIGAN and KNOLLE share a
YVDL sequence that may act an AP-dependent sorting motif,
although its physiological significance and specificity remain
to be determined (for a review, see Bonifacino and
Dell’Angelica, 1999).
Independently of specific sorting signals, a general
redirection of membrane flow may be involved in plant
cytokinesis. Supporting evidence comes from two recent
observations. The Arabidopsis putative auxin efflux carrier
PIN1, an integral membrane protein, which is normally located
in the basal plasma membrane of non-proliferating vascular
cells, also accumulates at the forming cell plate (Steinmann
et al., 1999). Furthermore, a secreted enzyme, cell wallassociated endoxyloglucan transferase, has been reported to
traffic to the plasma membrane during interphase and to the
cell plate during cytokinesis via the endoplasmic reticulumGolgi pathway in tobacco BY-2 cells (Yokoyama and Nishitani,
2001). These observations suggest that the vast majority of
vesicles budding from the trans-Golgi during M phase traffic
to the plane of cell division. These vesicles may incorporate
any membrane or soluble cargo protein that passes through the
Golgi stacks at that time and lacks a retention signal.
Accordingly, KNOLLE protein would not need a sorting motif.
Whatever the underlying mechanism, only KNOLLE protein
that is synthesised during M phase can be targeted to the plane
of cell division. Consequently, the level of KNOLLE
expression during M phase may be a crucial parameter for
cytokinetic vesicle fusion.
Cytokinesis requires strong KNOLLE expression
The 35S::KN transgene yielded approximately hundred-fold
accumulation of KNOLLE protein in seedlings, when
compared with the wild-type control. This result is consistent
with the common use of the 35S promoter for transgene
overexpression in plants (Holtorf et al., 1996; Lermontova and
Grimm, 2000; Sentoku et al., 2000). However, the 35S::KN
transgene did not complement knolle mutant embryos. One
difference between developing embryos and seedlings is that
embryo cells are proliferating, whereas most cells in the
seedling are not. As shown by in situ hybridisation and
immunostaining in seedling roots, 35S::KN transgene
expression resulted in the stable accumulation of KNOLLE
mRNA and protein in non-proliferating cells. Comparative in
situ hybridisation and immunostaining of 35S::KN transgenic
and wild-type embryos revealed the relative strength of the 35S
promoter in proliferating cells. Expression of the 35S::KN
transgene, if at all detectable, supplemented the wild-type
patchy pattern of KNOLLE mRNA accumulation by low-level
accumulation of KNOLLE mRNA in the primordia of the
cotyledons. The 35S promoter activity was independently
assessed in 35S::GUS embryos, which gave a similar
developmental expression pattern and level of expression as
35S::KN (data not shown). Our results are consistent with
previous results demonstrating 35S promoter activity only from
the heart stage on in 35S::GUS transgenic tobacco embryos
(Odell et al., 1994). Furthermore, no additional KNOLLE
protein accumulation was detected in 35S::KN transgenic
embryos, when compared with wild-type embryos. Taken
together, these observations suggest that the expression level
of the 35S::KN transgene in proliferating cells was insufficient
to rescue knolle mutant embryos.
The difference between the 35S::KN and the KNOLLE
rescue (KNRescue) constructs was confined to the 5′ region,
whereas both constructs contained the same genomic 3′
sequence. Thus, any difference in expression pattern and
intensity between the two constructs can be attributed to
different 5′ sequences, the KNOLLE cis-regulatory region as
Regulation of KNOLLE syntaxin
opposed to the 35S promoter. The KNOLLE 5′ sequence appears
to integrate signals that link KNOLLE expression to the cell
cycle as indicated by the patchy pattern of mRNA
accumulation. Promoter elements conferring M phase-specific
transcription have been identified in mitotic cyclin genes (Ito et
al., 1998). The KNOLLE 5′ UTR should also contain a sequence
that enables translation of the mRNA during M phase, when
most protein expression is shut down (for a review, see Sachs,
2000). However, KNOLLE expression is not strictly linked to
karyokinesis, as KNOLLE protein accumulates between nonmitotic nuclei during endosperm cellularisation (Lauber et al.,
1997; Otegui and Staehelin, 2000).
In contrast to the KNOLLE promoter, the 35S promoter
appears to be active in a cell cycle-independent manner.
KNOLLE mRNA accumulated stably in non-proliferating cells
of 35S::KN transgenic seedlings but only transiently in
proliferating cells. Instability of short-lived mRNAs has been
attributed to specific sequences in the 3′ UTR (Gutierrez et al.,
1999; Sachs, 2000). In the case of KNOLLE mRNA, an as yet
undefined degradation signal appears to be linked to the M
phase and/or cytokinesis. The lack of strong accumulation of
KNOLLE mRNA in proliferating cells of 35S::KN transgenic
embryos and seedlings suggests that the activity of the 35S
promoter is too low in proliferating cells or does not counteract
efficiently the cell cycle-dependent mRNA degradation. By
contrast, the endogenous KNOLLE promoter is strong enough
to yield high levels of mRNA and protein accumulation in
proliferating cells, although it is only active during a brief
period of the cell cycle. Thus, during its period of activity, the
endogenous KNOLLE promoter is clearly stronger than the 35S
promoter, and this difference appears to be crucial for the
execution of cytokinesis.
In summary, there is no obvious need for the observed tight
regulation of KNOLLE expression, provided enough
KNOLLE protein is available during M phase to ensure
efficient vesicle fusion during cell-plate formation. This
demand is met by the strong KNOLLE promoter, which is
highly active during the period preceding cytokinesis. If there
were no cell cycle-dependent degradation of KNOLLE mRNA
and protein, both would stably accumulate. Although
mistargeting of KNOLLE protein to the plasma membrane
appears not to be harmful, it is also not useful. Perhaps
proliferating cells gain some selective advantage from linking
the degradation of KNOLLE mRNA and protein, as well as the
promoter activity, to the cell cycle.
We thank W. Lukowitz for kindly providing the cosmid 74-4, G.
Cardon for the pBarA and pBar-35S vectors and the Agrobacterium
strain GV3101, T. Jack for the pAP3 vector, U. Mayer for the knolle
allele UU1319, and W. Michalke for the monoclonal anti-plasma
membrane H+-ATPase antibody. We also thank S. Mangold and T.
Pacher for help with the immunoblotting, and N. Geldner, M. Heese,
M. Lenhard, Jaideep Mathur, U. Mayer and K. Schrick for critical
reading of the manuscript. This work was supported by grant SFB
446/B-8 from the Deutsche Forschungsgemeinschaft.
REFERENCES
Assaad, F. F., Mayer, U., Wanner, G. and Jürgens, G. (1996). The KEULE
gene is involved in cytokinesis in Arabidopsis. Mol. Gen. Genet. 253, 267277.
3011
Assaad, F. F., Huet, Y, Mayer, U. and Jürgens, G. (2000). The cytokinesis
gene KEULE encodes a Sec1 protein which binds the syntaxin KNOLLE.
J. Cell Biol. 152, 531-543.
Bechtold, N. and Pelletier, G. (1998). In planta Agrobacterium-mediated
transformation of adult Arabidopsis thaliana plants by vacuum infiltration.
Methods Mol. Biol. 82, 259-266.
Bechtold, N., Jaudeau, B., Jolivet, S., Maba, B., Vezon, D., Voisin, R. and
Pelletier, G. (2000). The maternal chromosome set is the target of the TDNA in the in planta transformation of Arabidopsis thaliana. Genetics 155,
1875-1887.
Benfey, P. N., Ren, L. and Chua, N. H. (1989). The CaMV 35S enhancer
contains at least two domains which can confer different developmental and
tissue-specific expression patterns. EMBO J. 8, 2195-2202.
Black, M. W. and Pelham, H. R. (2000). A selective transport route from
golgi to late endosomes that requires the yeast GGA proteins. J. Cell Biol.
151, 587-600.
Blatt M. R., Leyman B. and Geelen D. (1999). Molecular events of vesicle
trafficking and control by SNARE proteins in plants. New Phytol. 144, 389418.
Bonifacino, J. S. and Dell´Angelica, E. C. (1999). Molecular bases for the
recognition of tyrosine-based sorting signals. J. Cell Biol. 145, 923-926.
Burgess, R. W., Deitcher, D. L. and Schwarz, T. L. (1997). The synaptic
protein syntaxin1 is required for cellularization of Drosophila embryos. J.
Cell Biol. 138, 861-875.
Clague, M. J. and Herrmann, A. (2000). Deciphering fusion. Curr. Biol. 10,
R750-R752.
Clough, S. J. and Bent, A. F. (1998). Floral dip: a simplified method for
Agrobacterium-mediated transformation Arabidopsis thaliana. Plant J. 16,
735-743.
Darsow, T., Burd, C. G. and Emr, S. D. (1998). Acidic di-leucine motif
essential for AP-3-dependent sorting and restriction of the functional
specificity of the Vam3p vacuolar t-SNARE. J. Cell Biol. 142,:913-922.
da Silva Conceicao, A., Marty-Mazars, D., Bassham, D. C., Sanderfoot,
A. A., Marty, F. and Raikhel, N. V. (1997). The syntaxin homolog
AtPEP12p resides on a late post-Golgi compartment in plants. Plant Cell
9, 571-582.
Desfeux, C., Clough, S. J. and Bent, A. F. (2000). Female reproductive tissues
are the primary target of Agrobacterium-mediated transformation by the
Arabidopsis floral-dip method. Plant Physiol. 123, 895-904.
Fasshauer, D., Antonin, W., Margittai, M., Pabst, S. and Jahn, R. (1999).
Mixed and non-cognate SNARE complexes. Characterization of assembly
and biophysical properties. J. Biol. Chem. 274, 15440-15446.
Fuerst, R. A., Soni, R., Murray, J. A. and Lindsey, K. (1996) Modulation
of cyclin transcript levels in cultured cells of Arabidopsis thaliana. Plant
Physiol. 112, 1023-1033.
Fukuda, R., McNew, J. A., Weber, T., Parlati, F., Engel, T. Nickel, W.,
Rothman, J. E. and Söllner, T. H. (2000). Functional architecture of an
intracellular membrane t-SNARE. Nature 407, 198-202.
Galway, M. E., Heckman, J. W., Jr. and Schiefelbein, J. W. (1997). Growth
and ultrastructure of Arabidopsis root hairs: the rhd3 mutation alters vacuole
enlargement and tip growth. Planta 201, 209-218.
Griffiths, G. (1993). In Fine Structure Immunocytochemistry (ed. G. Griffiths),
pp. 174-177. Heidelberg: Springer Verlag.
Gutierrez, R. A., MacIntosh, G. C. and Green, P. J. (1999). Current
perspectives on mRNA stability in plants: multiple levels and mechanisms
of control. Trends Plant Sci. 4, 429-438.
Heese, M., Mayer, U. and Jürgens, G. (1998). Cytokinesis in flowering
plants: cellular process and developmental integration. Curr. Opin. Plant
Biol. 1, 486-491.
Holtorf, S., Apel, K. and Bohlmann, H. (1996). Comparison of different
constitutive and inducible promoters for the overexpression of transgenes in
Arabidopsis thaliana. Plant Mol. Biol. 29, 637-646.
Ito, M., Iwase, M., Kodama, H., Lavisse, P., Komamine, A., Nishihama,
R., Machida, Y. and Watanabe, A. (1998). A novel cis-acting element in
promoters of plant B-type cyclin genes activates M phase-specific
transcription. Plant Cell 10, 331-341.
Ito, M. (2000). Factors controlling cyclin B expression. In The Plant Cell
Cycle (ed. D. Inzé). Plant Mol. Biol. 43, 677-690.
Jack, T., Brockman, L. L. and Meyerowitz, E. M. (1992). The homeotic
gene APETALA3 of Arabidopsis thaliana encodes a MADS box and is
expressed in petals and stamens. Cell 68, 683-697.
Jack, T., Fox, G. L. and Meyerowitz, E. M. (1994). Arabidopsis homeotic
gene APETALA3 ectopic expression: transcriptional and posttranscriptional
regulation determine floral organ identity. Cell 76, 703-716.
3012
JOURNAL OF CELL SCIENCE 114 (16)
Jahn, R. and Südhof, T. C. (1999). Membrane fusion and exocytosis. Annu.
Rev. Biochem. 68, 863-911.
Jantsch-Plunger, V. and Glotzer, M. (1999). Depletion of syntaxins in the
early Caenorhabditis elegans embryo reveals a role for membrane fusion
events in cytokinesis. Curr. Biol. 9, 738-745.
Joshi, C. P. (1987). An inspection of the domain between putative TATA box
and translation start site in 79 plant genes. Nucleic Acids Res. 15, 66436653.
Langanger, G., de Mey, J. and Adam, H. (1983). 1,4-Diazobizyklo-[2.2.2.]Octan verzögert das Ausbleichen von Immunfluoreszenzpräparaten.
Mikroskopie (Wien) 40, 237-241.
Lauber, M. H., Waizenegger, I., Steinmann, T., Schwarz, H., Mayer, U.,
Hwang, I., Lukowitz, W. and Jürgens, G. (1997). The Arabidopsis
KNOLLE protein is a cytokinesis-specific syntaxin. J. Cell Biol. 139, 14851493.
Lermontova, I. and Grimm, B. (2000). Overexpression of plastidic
protoporphyrinogen IX oxidase leads to resistance to the diphenyl-ether
herbicide acifluorfen. Plant Physiol. 122, 75-84.
Lukowitz, W., Mayer, U. and Jürgens, G. (1996). Cytokinesis in the
Arabidopsis embryo involves the syntaxin-related KNOLLE gene product.
Cell 84, 61-71.
Mayer U., Torres-Ruiz R. A., Berleth T., Miséra S. and Jürgens G. (1991).
Mutations affecting body organization in the Arabidosis embryo. Nature
353, 402-407
Mayer, K. F. X., Schoof, H., Haecker, A., Lenhard, M., Jürgens, G. and
Laux, T. (1998). Role of WUSCHEL in regulating stem cell fate in the
Arabidopsis shoot meristem. Cell 95, 805-815.
McNew, J. A., Parlati, F., Fukuda, R., Miller, R., Söllner, T. H. and
Rothman, J. E. (2000). Compartmental specificity of cellular membrane
fusion encoded in SNARE proteins. Nature 407, 153-159.
Meyer, K., Leube, M. P. and Grill, E. (1994). A protein phosphatase 2C
involved in ABA signal transduction in Arabidopsis thaliana. Science 264,
1452-1455.
Nacry, P., Mayer, U. and Jürgens, G. (2000). Genetic dissection of
cytokinesis. In The Plant Cell Cycle (ed. D. Inzé). Plant Mol. Biol. 43, 719733.
Nicol, F., His, I., Jauneau, A., Vernhettes, S., Canut, H. and Höfte, H.
(1998). A plasma membrane-bound putative endo-1,4-b-D-glucanase is
required for normal wall assembly and cell elongation in Arabidopsis.
EMBO J. 17, 5563-5576.
Odell, J. T., Hoopes, J. L. and Vermerris, W. (1994). Seed-specific gene
activation mediated by the Cre/lox site-specific recombination system. Plant
Physiol. 106, 447-458.
Otegui, M. and Staehelin, L. A. (2000). Syncytial-type cell plates: a novel
kind of cell plate involved in endosperm cellularization of Arabidopsis.
Plant Cell 12, 933-947.
Parlati, F., McNew, J. A., Fukuda, R., Miller, R., Söllner, T. H. and
Rothman, J. E. (2000). Topological restriction of SNARE-dependent
membrane fusion. Nature 407, 194-198.
Robinson, D. N. and Spudich, J. A. (2000). Towards a molecular
understanding of cytokinesis. Trends Cell Biol. 10, 228-237.
Rodriguez, J. and Deinhardt, F. (1960). Preparation of semipermanent
mounting medium for fluorescent antibody studies. Virology 12, 316-317.
Sachs, A. B. (2000). Cell cycle-dependent translation initiation: IRES
elements prevail. Cell 101, 243-5.
Sambrook, J., Fritsch, E. F. and Maniatis, T. (1989). Molecular Cloning: A
Laboratory Manual, 2nd ed. Cold Spring Harbor, NY: Cold Spring Habor
Laboratory Press.
Samuels, A. L., Giddings, T. H., Jr and Staehelin, L. A. (1995). Cytokinesis
in tobacco BY-2 and root tip cells: a new model of cell plate formation in
higher plants. J. Cell Biol. 130, 1345-1357.
Sanderfoot, A. A., Assaad F. F and Raikhel N. V. (2000). The Arabidopsis
Genome. An abundance of soluble N-Ethylmaleimide-sensitive factor
adaptor protein receptors. Plant Physiol. 124, 1558-1569.
Sentoku, N., Sato, Y. and Matsuoka, M. (2000). Overexpression of rice OSH
genes induces ectopic shoots on leaf sheaths of transgenic rice plants. Dev.
Biol. 220, 358-364.
Slot, J. W. and Geuze, H. J. (1985). A new method for preparing gold probes
for multiple-labeling microscopy. Eur. J. Cell Biol. 38, 87-93.
Söllner, T., Bennett, M. K., Whiteheart, S. W., Scheller, R. H. and
Rothman, J. E. (1993a). A protein assembly-disassembly pathway in vitro
that may correspond to sequential steps of synaptic vesicle docking,
activation, and fusion. Cell 75, 409-418.
Söllner, T., Whiteheart, S. W., Brunner, M., Erdjument-Bromage, H.,
Geromanos, S., Tempst, P. and Rothman, J. E. (1993b). SNAP receptors
implicated in vesicle targeting and fusion. Nature 362, 318-324.
Soni, R., Carmichael, J. P., Shah, Z. H. and Murray J. A. H. (1995). A
family of cyclin D homologs from plant differentially controlled by growth
regulators and containing the conserved retioblastoma protein interaction
motiv. Plant Cell 7, 85-103.
Staehelin L. A. and Hepler P. K. (1996). Cytokinesis in higher plants. Cell
84, 821-824.
Steinmann, T., Geldner, N., Grebe, M., Mangold, S., Jackson, C. L., Paris,
S., Galweiler, L., Palme, K. and Jürgens, G. (1999). Coordinated polar
localization of auxin efflux carrier PIN1 by GNOM ARF GEF. Science 286,
316-318.
Straight, A. F. and Field, C. M. (2000). Microtubules, membranes and
cytokinesis. Curr. Biol. 10, R760-R770.
Sundaresan, V., Springer, P., Volpe, T., Haward, S., Jones, J. D., Dean, C.,
Ma, H. and Martienssen, R. (1995). Patterns of gene action in plant
development revealed by enhancer trap and gene trap transposable elements.
Genes Dev. 9, 1797-810.
Tang, B. L. and Hong, W. (1999). A possible role of di-leucine-based motifs
in targeting and sorting of the syntaxin family of proteins. FEBS Lett. 446,
211-212.
Tokuyasu, K. T. (1989). Use of poly(vinylpyrrolidon) and poly(vinyl alcohol)
for cryoultramicroscopy. Histochem J. 21, 163-171.
Vida, T. A. and Emr, S. D. (1995). A new vital stain for visualizing
vacuolar membrane dynamics and endocytosis in yeast. J. Cell Biol. 128,
779-792.
Waizenegger, I., Lukowitz, W., Assaad, F., Schwarz, H., Jürgens, G. and
Mayer, U. (2000). The Arabidopsis KNOLLE and KEULE genes interact to
promote vesicle fusion during cytokinesis. Curr. Biol. 10, 1371-1374.
Yang, Z. (1999). Signaling tip growth in plants. Curr. Opin. Plant Biol. 1, 525530.
Ye, G. N., Stone, D., Pang, S. Z., Creely, W., Gonzalez, K. and Hinchee,
M. (1999). Arabidopsis ovule is the target for Agrobacterium in planta
vacuum infiltration transformation. Plant J. 19, 249-257.
Yokoyama, R. and Nishitani, K. (2001). Endoxyloglucan transferase is
localized both in the cell plate and in the secretory pathway destined for the
apoplast in tobacco cells. Plant Cell Physiol. 42, 292-300.
Zhou, Q., Xiao, J. and Liu, Y. (2000). Participation of syntaxin 1A in
membrane trafficking involving neurite elongation and membrane
expansion. J. Neurosci. Res. 61, 321-328.
Zuo, J., Niu, Q.-W., Nishizawa, N., Wu, Y., Kost, B. and Chua, N.-H.
(2000). KORRIGAN, an Arabidopsis endo-1,4-b-glucanase, localizes to the
cell plate by polarized targeting and is essential for cytokinesis. Plant Cell
12, 1137-1152.