Download mbe.oxfordjournals.org - Oxford Academic

Nucleolar Binding Sequences of the Ribosomal Protein S6e Family Reside in
Evolutionary Highly Conserved Peptide Clusters
Swarupa Kundu-Michalik, Marc-Angelo Bisotti, Edgar Lipsius, Andreas Bauche, Antonina Kruppa,
Thomas Klokow, Gertrud Kammler,1 and Joachim Kruppa
Center of Experimental Medicine, Institute of Molecular Cell Biology, Hamburg University, D-20246 Hamburg, Germany
Proteomic analyses of the nucleolus have revealed almost 700 functionally diverse proteins implicated in ribosome
biogenesis, nucleolar assembly, and regulation of vital cellular processes. However, this nucleolar inventory has not
unveiled a specific consensus motif necessary for nucleolar binding. The ribosomal protein family characterized by their
basic nature should exhibit distinct binding sequences that enable interactions with the rRNA precursor molecules
facilitating subunit assembly. We succeeded in delineating 2 minimal nucleolar binding sequences of human ribosomal
protein S6 by fusing S6 cDNA fragments to the 5# end of the LacZ gene and subsequently detecting the intracellular
localization of the b-galactosidase fusion proteins. Nobis1 (nucleolar binding sequence 1), comprising of 4 highly conserved
amino acid clusters separated by glycine or proline, functions independently of the 3 authentic nuclear localization signals
(NLSs). Nobis2 consists of 2 conserved peptide clusters and requires the authentic NLS2 in its native context. Similarly, we
deduced from previous publications that the single Nobis of ribosomal protein S25 is also highly conserved. The functional
protein domain organization of the ribosomal protein S6e family consists of 3 modules: NLS, Nobis, and the C-terminal
serine cluster of the phosphorylation sites. This modular structure is evolutionary conserved in vertebrates, invertebrates, and
fungi. Remarkably, nucleolar binding sequences of small and large ribosomal proteins reside in peptide clusters conserved
over millions of years.
Introduction
The nucleolus is a highly dynamic nuclear structure
(Andersen et al. 2005) formed around tandemly repeated
genes of rDNA coding for preribosomal RNA (Hadijolov
1985). The major function of the nucleolus is the assembly
of ribosomal subunits (Raska et al. 2006). During ribosome
biogenesis, the rRNA precursor is transcribed at the border
between the fibrillar center and dense fibrillar component
(DFC), and in the DFC (Koberna et al. 2002). Ribosomal
RNA processing and base modifications as well as the association of rRNA with ribosomal proteins give rise to intermediates of preribosomal particles (Grandi et al. 2002;
Tschochner and Hurt 2003). These progress vectorially
through functional subdomains of the DFC into the granular
component (GC) for further maturation and completion of
ribosomal subunit assembly (Scheer and Hock 1999; Gerbi
et al. 2003). A myriad of small nucleolar ribonucleoprotein
particles (RNPs) assist the processing and modification of
the primary rRNA transcript (Fromont-Racine et al. 2003;
Granneman et al. 2004) so that ultimately mature 5.8S, 18S,
and 25S rRNA molecules are produced in Saccharomyces
cerevisiae (Venema and Tollervey 1999).
The advent of proteomic analyses of the nucleolus
(Andersen et al. 2002; Scherl et al. 2002) as well as of preribosomal particles (Takahashi et al. 2003) have revealed
countless trans-acting factors participating in the complex
pattern of preribosome maturation (Milkereit et al. 2003),
which is accompanied by a dynamic change in the composition and subnuclear distribution of ribosomal synthesis
factors (Leung et al. 2003; Hinsby et al. 2006). Fluorescene
1
Present address: Department of Neurological Surgery, Center of
Clinical Neurosciences, Hamburg University, D-20246 Hamburg,
Germany.
Key words: ribosomal protein, nuclear import, nucleolar binding
sequence, nuclear localization signal, ribosome biogenesis.
E-mail: [email protected].
Mol. Biol. Evol. 25(3):580–590. 2008
doi:10.1093/molbev/msn002
Advance Access publication January 4, 2008
Ó The Author 2008. Published by Oxford University Press on behalf of
the Society for Molecular Biology and Evolution. All rights reserved.
For permissions, please e-mail: [email protected]
recovery after photobleaching analyses have demonstrated
that some nucleolar components involved in ribosome biogenesis rapidly shuttle between the nucleolus and the nucleoplasm (Chen and Huang 2001).
Ribosomes are complexes essential for cell proliferation and cell growth present in all organisms (Mayer and
Grummt 2006; Bernstein et al. 2007). In bacteria, the catalytically active rRNA forms the framework upon which 55
ribosomal proteins are assembled, thereby stabilizing the
3-dimensional structure of the ribosomal subunits (Schuwirth
et al. 2005). Analogous to all other nuclear proteins, eukaryotic ribosomal proteins are synthesized in the cytoplasm,
subsequently imported through the nuclear pore complex
into the nucleoplasm, and ultimately accumulate in the nucleolus (Fromont-Racine et al. 2003). Their association
with the newly transcribed pre-rRNA generates a 90S preribosomal particle that is processed in a highly complex
pattern into 40S and 60S ribosomal subunits, which are
exported through the nuclear pore complex into the cytoplasm (Grandi et al. 2002; Fromont-Racine et al. 2003;
Tschochner and Hurt 2003). In mammalian cells, nuclear
import of ribosomal proteins (Schmidt et al. 1995) is mediated
by classical nuclear localization signals (NLSs) of either
monopartite or bipartite nature (Dingwall and Laskey
1991; Lipsius et al. 2005) and assisted by a variety of import
factors (Jäkel and Görlich 1998).
A specific mechanism for targeting proteins into the
nucleolus is not needed because the nucleolus is not surrounded by a lipid bilayer (Carmo-Fonseca et al. 2000).
Furthermore, analysis of the nucleolar proteome has demonstrated that a simple universal targeting motif shared by
all nucleolar proteins does not exist (Andersen et al. 2002;
Scherl et al. 2002) suggesting that they are instead sequestered and retained by binding to other nucleolar components (Carmo-Fonseca et al. 2000). Within proteins of
retroviruses (Hatanaka 1990), short nucleolar targeting signals of 12–20 amino acids can target a reporter protein from
the cytoplasm into the nucleolus.
It is assumed that the ribosome arose on a single occasion as a particle composed completely of RNA capable
Nucleolar Accumulation of Ribosomal Protein S6 581
Table 1
PCR Primers for Characterizing Nucleolar Binding Sequences
Primer
S6
S6
S6
S6
S6
S6
S6
Sequence in 5# / 3#
(A1)
(A53)
(A64)
(A72)
(A75)
(A100)
(A115)
GAAAGGATCCCCTTAAGATGAAGCTGAACATCTC
TTGGATCCCTTAAGAGTGGTGGGAACGACAAACAA
TTGGATCCCTTAAGAAGCAGGGTGTCTTGACCCAT
TTGGATCCCTTAAGCGTGTCCGCCTGCTACTGAGT
TTTTTATCTTAAGCTGCTACTGAGTAAGGGGCATTC
ATTTTATCTTAAGTGCATTGTGGATGAAATCTGAGC
TTTTTATCTTAAGAAAAAAGGAGAGAAGGATAT
TCCTGG
S6 (A170)
TTTGGATCCCTTAAGAGGACCAAAGCACCCAAG
S6 (A173)
TTTTTATCTTAAGGCACCCAAGATTCAGCGTCTT
GTTA
S6 (A180)
TTTGGATCCCTTAAGGTTACTCCACGTGTCCTG
S6 (A192)
GGATCCTTTCTTAAGATTGCTCTGAAGAAGCAGC
S6 (H94)
GGATCCAAAGCTTCTCTTTCTTTCTCCAGTTCT
S6 (H98)
GGATCCAAAGCTTCGAACTGATTTTCTCTTTCT
S6 (H102)
GGATCCAAAGCTTACAATGCAACCACGAACTGATT
S6 (H120)
GGATCCAAAGCTTATCCTTCTCTCCTTTTTTTACA
ATAA
S6 (H203)
GGATCCAAAGCTTTTATTTTTCTTGGTACGCTGCTT
S6 (H210)
GGATCCAAAGCTTGCATATTCTGCAGCCTCTT
S6 (H229)
GGATCCAAAGCTTGCAATTTGTTCCTGGCGC
S6 (H249)
GGATCCAAAGCTTTTCTGACTGGATTCAGACTT
S6 (Nhe170) GGATCCGCTAGCAGGTTTCTTACCTTCTTTATT
S6 (Nhe210) GGATCCGCTAGCAAACTTTTGGCCAAGAGAATG
NOTE.—The orientation in which the PCR primers have been used is indicated,
and the restriction sites are underlined.
of catalyzing peptide bond formation (Noller 1991; Wool
et al. 1995). Numerous established rRNA sequences of different phyla and species support this assumption by providing compelling evidence for the homology of rRNAs of all
species, which is more apparent in the comparison of secondary structure than of nucleotide sequences. In the
1970#s, Wool and Stöffler (1974) were already convinced
that ribosomal protein sequences from distant species are
also evolutionary related. Nowadays, genomic sequence
comparisons have confirmed the existence of homologous
proteins in ribosomes of Archaea, Bacteria, and Eukarya
(Lecompte et al. 2002; Mears et al. 2002). Presumably, evolutionary highly conserved clusters in these ribosomal protein sequences fulfill a crucial role in ribosome assembly
and function.
Research on the biogenesis of ribosomal subunits concentrating on rRNA transcription, processing, and maturation has neglected the influence of ribosomal proteins in the
assembly process. However, in 2005, Milkereit’s group
(Ferreira-Cerca et al. 2005) demonstrated that eukaryotic
ribosomal proteins play vital roles in the maturation and
transport of the pre-18S rRNA. Implied by this result is
the existence of specific amino acid sequences within ribosomal proteins, which optimally interact with their corresponding nucleotide sequences so that distinct pre-rRNA
processing steps can occur (Ferreira-Cerca et al. 2005).
Unfortunately, the exact sequences and structural features
of such binding domains in eukaryotic ribosomal proteins
have not yet been systematically investigated. Therefore,
we characterized the topogenic sequences of human ribosomal protein S6 in detail by delineating the regions required for nuclear targeting and nucleolar binding in
order to understand the organization and interrelationship
of these functional domains (Fukami-Kobayashi et al.
2007). To this end, we demonstrate that S6 has 2 nucleolar
binding sequences —Nobis1 (nucleolar binding sequence 1)
in the center functioning independently of the 3 authentic
NLSs and Nobis2 in the C-terminal region depending on
the presence of NLS2—both of which reside in regions
of highly conserved peptide clusters. Furthermore, we show
that NLS3 of human S6 is a classical bipartite import signal.
Materials and Methods
Constructs for the Delineation of Nobis1 in the Central
Region of S6
A set of deletion mutants was constructed to identify
a Nobis in the central region of S6. To this end, 2 polymerase chain reaction (PCR) fragments were designed using the
primers S6 (A1) and S6 (Nhe170) as well as S6 (Nhe210)
and S6 (H249) (table 1). The PCR fragments were digested
with AflII/NheI and NheI/HindIII, respectively, and cloned
together into the pASH vector (Lipsius et al. 2005), which
had been restricted with AflII/HindIII. Since the PCR primer
S6 (Nhe170) also hybridized to the S6 DNA sequence at
the nucleotides 414–420, an additional S6 fragment corresponding to amino acids 1–139 was synthesized so that a
second deletion mutant S6(1–249,D140–210) was obtained.
In order to narrow down Nobis1, additional constructs were
designed beginning at amino acid residues 53, 64, 72, 75,
100, and 115, respectively, by employing the indicated
primers (table 1) and the S6(1–249,D140–210) construct
as a template.
Additional constructs with consecutively shorter DNA
segments were prepared containing the exogenous SV40
NLS. The DNA fragments were generated by PCR using
the plasmid pBluescript KS( ) S6 as a template and the
corresponding primers (table 1). The PCR products were
incubated with the restriction enzymes AflII and HindIII
and ligated into the pASH-SV40 vector described
previously (Lipsius et al. 2005).
Site-Directed Mutagenesis of NLS3 in the Fragment
S6(215–240) and in the Tetrapeptide
Arginine 231 of NLS3 was mutated into valine,
glycine, and glutamic acid. Hybrids were prepared from
synthetic oligonucleotides as summarized in table 2 to obtain the tetrapeptides for fusion to b-galactosidase. These
hybrids were ligated into the vector pKHlacZ (Annilo
et al. 1998), which had been restricted with NotI and
HindIII. The correct constructs of the clones obtained
were verified by sequencing. Plasmid DNA was prepared
for transfections as previously described (Schmidt et al.
1995).
The fragment S6(215–240) was subcloned into the
vector M13mp19 and an oligonucleotide-dependent in vitro
mutagenesis was carried out as described by the manufacturer (Amersham-Buchler, Braunschweig, Germany). A set
of oligonucleotides was synthesized by using a mixture of
A, C, G, and T at position N in the sequence: 5#-ATTGCGAAGGNACGCAGACTT-3#. Competent Escherichia
coli XL1-Blue cells were transformed with the mutated
582 Kundu-Michalik et al.
Table 2
Oligonucleotides Used for Site-Directed Mutagenesis and
Hybrid Formation
Constructs
Sequence
NLS3 wt
NLS3 wt
R230G
R231G
R231V
R231V
R231E
R231E
D215/216
D223/224
T-Ag1
T-Ag2
5#-GGCCGCAAAAGAAGAAGAATA-3#
3#-CGTTTTCTTCTTCTTATTCGA-5#
5#-GGCCGCAAAGGAAGAAGAATA-3#
3#-CGTTTCCTTCTTCTTATTCGA-5#
5#-GGCCGCAAAGTAAGAAGAATA-3#
3#-CGTTTCATTCTTCTTATTCGA-5#
5#-GGCCGCAAAGAAAGAAGAATA-3#
3#-CGTTTCTTTCTTCTTATTCGA-5#
5#-CCAGTGAATTCGGCCATGAAGGAGGCTAAG-3#
5#-AAGGAGGCTAAGGAGCAGGAACAAATTGCG-3#
5#-GGCCGCCCGAAAAAAAAACGCAAAGTGG-3#
3#-CGGGCTTTTTTTTTGCGTTTCACCTTAA-5#
NOTE.—Oligonucleotides were purchased from MWG Biotech AG (Ebersberg,
Germany) and used either for site-directed mutagenesis or hybrid formation. The
nucleotides in bold represent codons of site-directed mutagenesis.
M13mp19 RF DNA that contained mutated S6 fragments.
The clones were isolated and sequenced. Only 3 of the 4
theoretically possible mutations were obtained, that is, valine, glycine, and glutamic acid but not alanine. The individual S6 cDNA fragments were isolated from the
corresponding M13 constructs, sequenced, and subcloned
into pPbS6 as previously described (Schmidt et al.
1995).
The KR deletion mutants were constructed as follows:
the fragment S6(215–240) containing the valine mutation
was excised from the corresponding pPbS6 with EcoRI
and HindIII and ligated into pUC19. To construct the
deletion mutants S6(215–240,D215/216) and S6(215–
240,D223/224), the primers in table 2 were used in the
site-directed mutagenesis. The mutants were selected after
a ScaI restriction in the E. coli strain BMH71-18 mutS.
After a second ScaI restriction, the isolated plasmids were
transformed into E. coli JM105 cells, and their correct
sequence was verified.
A NotI linker had to be added to the excised S6
fragment after filling up the cohesive ends with the
Klenow fragment of DNA polymerase I. The modified
constructs were subcloned into the NotI/HindIII sites of
the vector pKHlacZ where they were in frame with bgalactosidase. After ligation, the correct frame was verified
by sequencing.
Tagging of S6 Fragments Lacking the 3 Authentic NLSs
with the Heterologous SV40 NLS
To produce the SV40 NLS–tagged S6 constructs, the
oligonucleotides T-Ag1 and T-Ag2 (table 2) were hybridized giving rise to a double-stranded DNA fragment with a
NotI site at the 5# end and an EcoRI site at the 3# end. The
SV40 NLS tag was inserted into NotI and EcoRI sites of the
plasmid KS-S6DNLS1-3, which contained the S6(3–240)
fragment with the triple NLS deletion in its EcoRI and
HindIII sites. The correct frame of the tag insertion was
verified by sequencing. After transformation of E. coli
XL1-Blue cells, the plasmid was isolated and purified.
The fragment containing the SV40 NLS tag and the S6
sequence was excised by NotI and HindIII and ligated
into the corresponding sites of pKHlacZ in order to fuse
the S6 construct to the 5# end of the b-galactosidase gene.
The hybrid gene was in the correct reading frame of
the ATG codon of the pKHlacZ vector as was verified
by sequencing.
The S6 deletion mutant lacking all 3 authentic NLSs of
S6 was the one published previously (Schmidt et al. 1995)
corresponding to amino acids 3–240 of human ribosomal
S6 protein. The DNA sequence was obtained as an EcoRI/
HindIII fragment, which was subcloned into pUC18. To obtain the correct reading frame in the planned construct, an
excess single cytidine residue adjacent to the EcoRI site had
to be deleted. After the successful deletion, the fragment
was inserted into the HindIII/EcoRI site of pBluescript
KS( ), and the correct sequence was verified. The
S6(3–240) sequence was excised from the pBluescript vector with NotI/HindIII and cloned into the corresponding
sites of pKHlacZ. Sequencing of the final construct showed
that the open reading frame of S6 was correctly initiated
with the AUG codon of pKHlacZ giving rise to the expected fusion protein. The cDNA fragment coding for
S6(173–249,D1–3) was obtained by PCR from an S6 template lacking the 3 authentic NLSs using the primers listed
in table 1. The PCR product was digested with AflII/HindIII
and ligated into the corresponding sites of pASH-SV40
(Lipsius et al. 2005).
Cell Culture Techniques
Cell culture, transfection, and intracellular localization
of fusion proteins by indirect immunostaining as well as
histochemical localization of b-galactosidase activity
were carried out as described previously (Lipsius et al.
2005).
Construction of S6 Fragments for the Nucleolar Binding
Domain (Nobis2) Encompassing NLS2
Starting from the S6 cDNA, several constructs
containing a single NLS, either NLS2 or NLS3, were designed and synthesized by PCR using the primers indicated
in table 1. All the fragments were purified by the QIAEX II
gel extraction kit (Qiagen, Hilden, Germany) before
restriction digestion with AflII and HindIII and then subcloned into the corresponding sites of the expression vector
pASH. The final expression constructs were verified by
sequencing.
Results
Delineation of Nobis1 in the Central Region of S6
In prokaryotes, early ribosomal binding proteins typically fold into globular structures that bind to multistem
junctions, thereby folding and fixing the conformation of
rRNA helices in their vicinity (Brodersen et al. 2002).
Human ribosomal protein S6 is categorized as a primary
RNA-binding protein because it associates with early
Nucleolar Accumulation of Ribosomal Protein S6 583
FIG. 1.—Nobis1 in the central region of S6. A set of deletion mutants starting from S6(1–170) was constructed by employing the endogenous
bipartite NLS3 to identify the minimal nucleolar binding sequence, Nobis1. Decreasingly shorter N-termini of the fragment S6(1–139) were tested for
their nucleolar binding ability. A second set of constructs with an exogenous SV40 NLS attached to the N-terminus was generated by PCR, in which the
C-terminus was consecutively shortened. All fusion proteins were expressed in COS cells. N, nuclear; No, nucleolar. Scale bar, 5 lm.
precursors to the 18S rRNA in the nucleolus (Bernstein
et al. 2004; Ferreira-Cerca et al. 2005). Comparison of eukaryotic S6 amino acid sequences revealed a high sequence
conservation between amino acids 54 and 154 implying that
this region plays a vital role in the 40S subunit assembly
and/or ribosomal function.
The b-galactosidase fusion construct containing the
fragment S6(3–183) was inefficiently targeted to the nucleus, which was attributed to the weak nature of NLS1
(Schmidt et al. 1995). Appending the C-terminal segment,
S6(210–249) containing the stronger NLS3 to the constructs greatly increased the efficiency of nuclear import
of the corresponding fusion proteins and made it possible
to examine the amino-terminal region of the S6 protein
(1–170) for its nucleolar binding capability (fig. 1; supplementary fig. S1, Supplementary Material online for a color
version). The first construct, S6(1–249,D171–209),
directed the b-galactosidase reporter into the nucleolus
implying that the amino-terminal half of S6 contains a nucleolar binding domain (fig. 1).
A rough estimate of the location of this Nobis was obtained using the construct S6(1–249,D140–209) fused to
b-galactosidase, which accumulated exclusively in the nucleolus (fig. 1). A series of amino-terminal deletions of S6
was studied to narrow down the region capable of nucleolar
binding: 115–139, 100–139, 75–139, 64–139, and 53–139.
Only the b-galactosidase fusion proteins containing
S6(53–249,D140–209) (data not shown) and S6(64–249,
D140–209) (fig. 1) accumulated in the nucleolus, whereas
all shorter fragments starting with S6(75–249,D140–209)
were merely imported into the nucleoplasm (fig. 1). The
amino-terminal border of Nobis1 was clearly defined by
the construct S6(72–249,D140–209) that included the
highly conserved tripeptide RVR as an N-terminal extension of the S6(75–249,D140–209) fragment (fig. 1 and supplementary fig. S3, Supplementary Material online).
To further narrow down Nobis1 by defining its Cterminal border, additional constructs containing the
exogenous SV40 NLS were generated by consecutively
shortening the C-terminus of the S6(72–139) fragment
(fig. 1). The fragments S6(72–120) and S6(72–102) gave
rise to a succinct nucleolar staining, whereas the
S6(72–98) fragment showed, in addition to a distinct nucleolar accumulation, a fainter staining of the nucleoplasm.
Shortening by 4 amino acids at the C-terminus produced
fragment S6(72–94), which was completely excluded from
the nucleolus recognizable by the dark spots appearing in
the stained nucleoplasm (fig. 1).
584 Kundu-Michalik et al.
eated monopartite NLS1 and NLS2 (Schmidt et al.
1995). Interestingly, this bipartite signal has been conserved over almost 1 billion years because it is also present
in ribosomal protein S6A of S. cerevisiae (Lipsius et al.
2005).
Nobis2: A Minimal Nucleolar Binding Domain
Encompassing NLS2
FIG. 2.—NLS3 of S6 is a bipartite import signal. The tetrapeptide
KRRR233 and the fragment S6(215–240) were mutated by site-directed
mutagenesis, fusion proteins with b-galactosidase were expressed in COS
cells, and the intracellular distribution of the constructs was visualized by
X-gal staining. C, cytoplasmic; N, nuclear. Scale bar, 5 lm.
230
In summary, the 27 amino acids of S6(72–98) representing Nobis1 have the capability to lead to an accumulation of the fusion protein in the nucleolus. This S6 peptide
sequence most probably interacts with the ribosomal 18S
rRNA, thereby sequestering the fusion protein in the nucleolus. These experiments demonstrate that a Nobis lacking
any endogenous NLS resides in the central and evolutionary highly conserved region of S6 (supplementary fig. S3,
Supplementary Material online).
NLS3 of Human Ribosomal Protein S6 Is of Bipartite
Nature
Incorporation of the stronger NLS3 not only improved
the efficiency of nuclear import but also surprisingly allowed for nucleolar accumulation, which prompted us to
carry out a detailed characterization of NLS3. The following substitutions in the tetrapeptide sequence 230KRRR233
of the arginine at position 231, R231V, R231G, and R231E,
gave rise to nonfunctional NLSs unable to direct the fused
b-galactosidase into the nucleoplasm (fig. 2; supplementary
fig. S2, Supplementary Material online for a color version).
This experimental result was predicted from the NLS consensus sequence K-R/K-X-R/K postulated by Chelsky et al.
(1989). Remarkably, all 3 mutations were ineffective in the
S6 context of the S6(215–240) fragment because the bgalactosidase fusion construct was still targeted into the nucleus (fig. 2). Hence, additional sequence elements of S6 are
most probably responsible for the unexpected highly efficient nuclear import unraveling the bipartite nature of
NLS3. Deletions of the dipeptides KR, which are 5 and
13 amino acids upstream of the mutated tetrapeptide, revealed that 215KR216 is essential for nuclear targeting in
the presence of the mutated peptide KVRR (fig. 2). The
fragment S6(215–240) was incapable of accomplishing nucleolar binding and, therefore, suitable to use as a nuclear
import signal in the series of constructs presented in figure 1.
In short, NLS3 represents a bipartite signal in human
ribosomal protein S6 in contrast to the previously delin-
The sequence of human ribosomal protein S6 contains
the peptide 188KRRRIALKKQRTKKNK203, which is
highly reminiscent of the nucleolar localization signals of
the retroviral proteins rex, rev, and tat (Hatanaka 1990).
Interestingly, this peptide sequence is the core element
of the rather large fragments, S6(138–198) and
S6(183–240), which targeted b-galactosidase into the nucleolus (Schmidt et al. 1995). Based on these observations,
the existence of a shorter nucleolar binding domain in the
region of NLS2 was postulated. To test this hypothesis, the
S6(180–210) fragment fused to the N-terminus of b-galactosidase was constructed (fig. 3). The corresponding fusion
protein was imported into the nucleus due to the presence
of NLS2, however, it was excluded from the nucleolus
(fig. 3). Extension of this peptide sequence by 10 amino
acids at the N-terminus gave rise to the S6 fragment
S6(170–210) which, when fused to b-galactosidase, was
able to target the reporter protein exclusively into the nucleolus (fig. 3). In an attempt to define the C-terminal
boundary of Nobis2, 12 amino acids were removed from
S6(170–210) giving rise to S6(170–198), which abolished
nucleolar accumulation (data not shown).
A sequence comparison of the eukaryotic S6e family
members called our attention to an evolutionary highly conserved S6 peptide cluster between 2 proline residues:
174
PKIQRLVTP182 (supplementary fig. S3, Supplementary
Material online). The shortest construct, S6(173–203), containing this peptide imported the fusion protein into the nucleolus (fig. 3). Presumably, the evolutionary conserved
cluster between amino acids 174 and 182 functions as an
essential domain vital for nucleolar binding of this S6 fusion protein (fig. 3). The fusion constructs, S6(180–229)
and S6(170–229), support the observation that the highly
conserved peptide leads to an accumulation of the fusion
proteins in the nucleolus (fig. 3). The fragment S6(192–
249), which is an N-terminal extension of S6(210–249)
used for the characterization of Nobis1, is also imported into the nucleus due to NLS3. A distinct nucleolar staining is
absent because NLS2 and the highly conserved peptide
cluster were removed (fig. 3).
Taken together, the minimal Nobis2 reminiscent of
retroviral nucleolar targeting signals consists of a cluster
of evolutionary highly conserved amino acids encompassing NLS2 as the core element (supplementary fig. S3, Supplementary Material online).
Nobis1 Suffices for Accumulation of S6 in the Nucleolus
The 13 basic amino acids of the 3 NLSs contribute 13
positive charges, which may prove essential for ionic
Nucleolar Accumulation of Ribosomal Protein S6 585
NLSs, as demonstrated by the constructs SV40-S6(3–
240,D1–3) and SV40-S6(72–120). This interpretation
was supported by an SV40 construct comprising amino
acids 173–249 but lacking all authentic NLSs, which
was imported into the nucleoplasm and excluded from
the nucleoli (fig. 4). Hence, Nobis2 in the C-terminal half
of S6 is dependent on the presence of NLS2 in its native,
evolutionary highly conserved context because the SV40
NLS could not restore nucleolar accumulation of the
S6(173–249,D1–3) fragment (fig. 4).
Although the presence of the endogenous NLS2 is vital for the functioning of Nobis2, the deletion of all 3 NLSs
still leads to nucleolar accumulation of S6 because Nobis1
remains intact in the construct SV40-S6(3–240,D1–3).
Thus, Nobis1, residing in the highly conserved central
region of S6, suffices for nucleolar binding of S6.
Both Nucleolar Binding Sequences of the S6e Family
Are Evolutionary Conserved
FIG. 3.—Characterization of Nobis2 encompassing NLS2. Starting
from the previously published fragment S6(183–239) containing NLS2
and NLS3 (Schmidt et al. 1995), a minimal Nobis was delineated by
systematically altering the length of the S6 fragments, which were
obtained by PCR. The corresponding fusion proteins with b-galactosidase
were expressed in COS cells and detected by indirect immunostaining.
N, nuclear; No, nucleolar. Scale bar, 5 lm.
interactions with the 18S rRNA or other nucleolar factors.
Deletion of the 3 NLSs gives rise to an S6 molecule that
fails to promote the nuclear import of b-galactosidase
(Schmidt et al. 1995). Fusing the SV40 NLS to the
amino-terminal end of this triple deletion mutant resulted
in nuclear import and recovery of the nucleolar targeting
ability of S6 (fig. 4), most probably due to the presence
of Nobis1, which functions independently of the 3 authentic
The delineated minimal sequences Nobis1 and Nobis2
from human ribosomal protein S6 were aligned with the
corresponding sequences of 9 selected species from vertebrates, invertebrates, and fungi (supplementary table S1,
Supplementary Material online) to create a consensus logo.
The combined logos of all 27 selected species are depicted
in figure 5, and the logos of the subgroups are shown in
supplementary figure S3 (Supplementary Material online
for a color version).
The 4 boxes of Nobis1 designated A–D are almost
completely conserved in the 9 vertebrate species used for
comparison (supplementary fig. S3, Supplementary Material online). The Nobis1 of rainbow trout differs only by 3
amino acids: 1 in box A and 2 in box D. A variation in the
C-terminal amino acids of box A and C is present in Nobis1
from invertebrates, whereas the clusters of box B and D are
almost completely invariant. When comparing the 9 S6 of
fungi, a similar pattern of sequence conservation can be deduced. Combining the vertebrates, invertebrates, and fungi
produces the following sequence pattern of Nobis1: the
N-termini of box A and C as well as the entirety of box
B and D are highly conserved, whereas the C-termini of
box A and C are variable (fig. 5). A similar pattern of
sequence conservation with minor deviations can be
observed in the Nobis1 of plants with established sequences: Nicotiana tabacum, Asparagus officinalis, Zea mays,
Arabidopsis thaliana, and Oryza sativa. The basic structure
and pattern of sequence conservation characteristic of
Nobis1 are also displayed in the S6e family member
Pyrococcus horikoshii of the Archaea.
Nobis2 is almost fully conserved in the vertebrate
group (fig. 5 and supplementary fig. S3, Supplementary
Material online for a color version). Invertebrates and fungi
display a peptide cluster in box A that is similar to the vertebrates, whereas an invariant distribution of positive
charges is exhibited in box B, albeit the amino acid sequences vary considerably (supplementary fig. S3, Supplementary Material online). Characteristic features of Nobis2 are
the complete invariance of box A—when conserved amino
acid exchanges are taken into account—and the high
586 Kundu-Michalik et al.
FIG. 4.—Nucleolar binding of the S6 fusion proteins lacking the 3 authentic NLSs. The triple NLS deletion mutant, S6(3–240,D1–3), was tagged
with the SV40 NLS at the N-terminus, and the corresponding cDNA was cloned into pKHlacZ. S6(3–240) containing the 3 authentic NLSs is depicted
as a control. In addition, a fragment containing Nobis1 located in the central region of S6 is shown, which is amino terminally tagged with the classical
SV40 NLS. The S6 cDNA fragment coding for S6(173–249,D1–3) was cloned into pASH-SV40, and the b-galactosidase fusion protein containing an
SV40 NLS at the N-terminus was expressed in COS cells. N, nuclear; No, nucleolar. Scale bar, 5 lm.
density of positive charges distributed in 3 unequally sized
clusters that are separated by 2 doublets of uncharged,
mostly aliphatic amino acids in box B (fig. 5). This pattern
is also present in the Nobis2 of plants (N. tabacum, A. officinalis, Z. mays, A. thaliana, and O. sativa).
Interestingly, the S6e family members of Archaea,
which have shorter protein sequences that are discontinued
soon after Nobis1, do not contain an rRNA-binding sequence comparable to Nobis2.
Discussion
Differential Import Efficiencies of the 3 S6 NLSs
The efficiency of the S6 delivery to the nucleus is exceptionally high because no free S6 protein, that is, not assembled into 40S subunits, can be detected in the cytoplasm
during interphase (Wool and Stöffler 1976). Apparently, the
FIG. 5.—Consensus sequences of Nobis1 and Nobis2 from the
eukaryotic S6e family. The conserved Nobis1 (line 1) and Nobis2 (line 2)
of 27 species listed in supplementary table S1 (Supplementary Material
online) were aligned, and a consensus sequence logo was created using
WebLogo (Schneider and Stephens 1990; Crooks et al. 2004) available at:
http://weblogo.berkley.edu/logo.cgi.
import machinery flawlessly and rapidly translocates nearly
3,000 S6 molecules per min per HeLa cell from the cytoplasm into the nucleus (Kruppa A, Kruppa J, unpublished
data).
Human ribosomal protein S6 has 3 NLSs each able to
direct the reporter protein b-galactosidase into the nucleus,
thereby leading to the accumulation of the corresponding
fusion protein in the nucleolus (Schmidt et al. 1995).
Detailed analysis revealed the bipartite nature of NLS3
in contrast to the monopartite NLS1 and NLS2 (fig. 2).
Human S6 and yeast S6A protein are endowed with 3
distinct import signals differing in their transport efficiencies (Schmidt et al. 1995; Lipsius et al. 2005), albeit a single NLS is sufficient to direct a reporter protein into the
nucleus in vivo. Phosphorylation of the serine cluster at
the C-terminus may affect the adjacent NLS3 by decreasing
the affinity of the target sequence for the import factors.
Hence, nuclear import would primarily have to rely on
NLS2 because NLS1 is a weak import signal (Schmidt et al.
1995). Eukaryotic cells possess different importins with
distinct NLS-binding specificities; therefore, the affinity
of the importin–NLS interaction (Fontes et al. 2003) is
the critical parameter in determining transport efficiency.
The limiting cellular concentration of these importins as
well as of the guanosine triphosphate–binding factor Ran
influence the extent of nucleocytoplasmic transport (Jans
et al. 2000).
Differences in import efficiencies within the 3 functionally distinct NLSs of ribosomal protein L5 have also
been observed (Claussen et al. 1999; Rosorius et al. 2000).
Only L5-NLS1 binds to a number of importins in vitro.
However, in vivo L5-NLS1 and L5-NLS3 mediate the nuclear import of the 5S RNP. On the contrary, L5-NLS2 is
incapable of translocating a heterologous 5S RNP into the
nucleoplasm (Claussen et al. 1999).
Remarkably, the number, nature, and position of the
targeting signals in S6 and L5 are evolutionary conserved.
Specifically, the number of NLSs—2 monopartite and 1
bipartite—as well as their positions at the C-terminus of
Nucleolar Accumulation of Ribosomal Protein S6 587
ribosomal protein S6 have been conserved in vertebrates,
invertebrates, and fungi (Ruvinsky and Meyuhas 2006).
Characteristic Features of the 2 S6 Nucleolar Binding
Sequences Conserved throughout Evolution
After entering the nucleoplasm, the import complexes
dissociate releasing the S6 protein. Given that there is no
structural or functional evidence for a membrane barrier
separating the nucleolus from the surrounding nucleoplasm, the imported soluble S6 protein should migrate into
the nucleolar compartment where it associates with the prerRNA as an early binding protein required for efficient early
cleavages (Ferreira-Cerca et al. 2005). S6 has been localized to the small head region of the 40S subunit near the
mRNA/tRNA-binding site (Volarevic and Thomas 2001).
Cross-linking studies have revealed that a region of the
S6 molecule extends to the subunit interphase where it
cross-links with L24 (Uchiumi et al. 1986). S6 interacts
with components of the ternary initiation complex, thus
contributing to the formation of the P-site on the small subunit (Bommer et al. 1980).
For the prokaryotic 30S and 50S ribosomal subunits,
the specific binding interactions between ribosomal proteins and the corresponding rRNA molecules have been
precisely defined by X-ray crystallography (Brodersen
et al. 2002; Klein et al. 2004). The atomic resolution structures of these subunits have demonstrated that most ribosomal proteins are located at the surface of the
respective particle. The 3-dimensional structures of these
proteins display globular domains with either internal extended a or b hairpin loops or long peptide extensions at
their N- or C-termini. These structural motifs deeply penetrate into the interior of the ribosomal subunit anchoring
each protein to the RNA core, thereby increasing the
percentage of protein surface interacting with the rRNA
(Brodersen et al. 2002; Klein et al. 2004).
In analogy to the shape of the prokaryotic ribosomal
proteins and their RNA interactions in stabilizing the 3dimensional architecture of the subunits, eukaryotic ribosomal proteins should also possess 1 or several regions that
serve as rRNA– and/or protein–protein binding domains
(Ramakrishnan and Moore 2001) giving rise to nucleolar
localization.
A single Nobis, either Nobis1 or Nobis2, is sufficient
to lead to an exclusive accumulation of S6 in the nucleolus
(figs. 1 and 3). The 27-amino-acid-long Nobis1—
(G)RVRLLLSKGHSCYRPRRTGERKRKSVR(G)—contains 12 basic residues amounting to 41% in this oligopeptide
comparedwithonly27%basicresiduesintheentireS6protein.
The N- and C-termini of Nobis1 are flanked by glycines
that provide a certain conformational flexibility to Nobis1.
Inherent to the amino acid sequence are several constraints
that affect the 3-dimensional folding of Nobis1 preventing
the formation of an extended a-helical structure: 1) electrostatic repulsion between successive basic residues (bold); 2)
bulkiness of adjacent R-groups (underlined) in Ser, Cys,
and Thr; and 3) occurrence of Pro and Gly residues (bold
italics). Thus, it is assumed that the specific features of this Nobisareaperfectmatchforthe18SrRNA;thisS6protein–rRNA
interaction occurs early during particle assembly in the GC
of the nucleolus (Krüger et al. 2007) giving rise to the
small-subunit processome (Bernstein et al. 2004). Specific
binding of ribosomal protein S6 to distinct nucleolar proteins
was not detected during protein interaction mapping in S.
cerevisiae (Gavin et al. 2006; Reguly et al. 2006).
Taken together, the sequence comparisons (fig. 5 and
supplementary fig. S3, Supplementary Material online)
demonstrate that Nobis1 plays an important role in the
phylogenetic domain of Eukarya and was already established in the Archaea, which lack a nuclear compartment,
implying that the highly basic Nobis1 is interacting with
a specific, presumably evolutionary conserved rRNA sequence. It has not escaped our notice that nature employed
existing basic amino acid sequences as nucleolar binding
sequences after the appearance of the nucleus.
As mentioned in the results, Nobis2 is dependent on
the functional NLS2 (fig. 4). Nobis2—APKIQRLVTP
RVLQHKRRRIALKKQRTKKNK—comprises of 31
amino acids, 12 of which are basic in nature. The basic residues correspond to 39% in this oligopeptide compared
with only 27% in the entire S6 protein. The structural constraints mentioned for Nobis1 also hold true for Nobis2,
thereby creating a positively charged, flexible binding sequence capable of optimally interacting with the 18S rRNA
backbone.
Nobis1 and Nobis2 differ in 1 important aspect:
Nobis1 resides in a region of the S6 protein sequence that
lacks any NLS, whereas the functioning of Nobis2 is
crucially dependent on NLS2 because deletion of NLS2
in SV40-S6(173–249,D1–3) concomitantly results in a loss
of nucleolar accumulation (fig. 4). Thus, integration of an
NLS into the second Nobis of S6 ascertains the efficient
recognition of the newly synthesized ribosomal protein
by the nuclear import machinery, thereby leading to a rapid
import into the nucleoplasm. Clearing the cytoplasm of the
highly basic ribosomal proteins seems vital to avoid the deleterious binding of ribosomal proteins to mRNAs that
would otherwise interfere with the translation process
(Wool and Stöffler 1976; Jäkel and Görlich 1998). The
nucleolar binding sequences are essential for driving the
subunit assembly in the nucleolus, thus positively influencing the growth rate of cells. The presence of an NLS in a
Nobis increases the efficiency of the ribosomal protein
delivery into the nucleus, for example, for Nobis2 of S6e
and for the Nobis of S25e. An NLS as an integral building
block is also found in the nucleolar binding sequences of
human S7 and L7a (table 3).
In essence, although nuclear targeting signals increase
import efficiency, NLSs are superfluous because ribosomal
proteins can diffuse through the nuclear pore into the nucleoplasm due to their low molecular weight, yet the presence of a Nobis is indispensable for nucleolar binding,
thereby facilitating subunit assembly.
Does the C-terminal Serine Cluster of S6 Contribute to
the 18S rRNA Binding?
The C-terminus of ribosomal protein S6 contains the
serine cluster of phosphorylation sites, which play an important role as determinants of cell size, cell proliferation,
588 Kundu-Michalik et al.
Table 3
Nuclear Localization Signals and Nucleolar Binding Sequences in Ribosomal Proteins
NLS
Nobis
Species
RP
Number
Length
Type
Number
Length
Reference
Homo sapiens
S6
S7
S19
S25
L5
L7a
L22
L31
S6A
S25
3
1
1
1
3
3
1
1
3
2
4/4/17
21
21
4
17/11
29/49/120
4
6
14/18/17
26/9
2 monopartite/1 bipartite
Bipartite-like
Bipartite
Monopartite
Monopartite
ND
Monopartite
Monopartite
2 monopartite/1 bipartite
Bipartite/Mata2-like
2
1
2
1
2
1
1
1
2
1
27/31
21
17/23
17
17/11
49
6
6
62/42
26
This paper
Annilo et al. 1998
Da Costa et al. 2003
Kubota et al. 1999
Rosorius et al. 2000
Russo et al. 1997
Shu-Nu et al. 2000
Quaye et al. 1996
Lipsius et al. 2005
Timmers et al. 1999
Rattus norvegicus
Saccharomyces cerevisiae
NOTE.—RP, ribosomal protein; ND, not determined.
and glucose homeostasis (Ruvinsky et al. 2005; Ruvinsky
and Meyuhas 2006). In vertebrates, the sequence of the serine cluster with its 5 phosphorylation sites is completely
conserved, whereas the amino acid sequence varies in invertebrates (Ruvinsky and Meyuhas 2006). In contrast,
fungi have to rely on a shorter C-terminus with just 2 serine
phosphorylation sites (Lipsius et al. 2005).
By proton nuclear magnetic resonance spectroscopy,
Katahira et al. (1996) obtained a solution structure for
the C-terminal end, S6(217–249), containing the serine
cluster for phosphorylation. This peptide folds into an
a-helix between E222 and R238, a distorted helical structure for the following 3 residues, and a flexible tail lacking
any secondary structure starting from S242 that must remain freely accessible to the p70 S6 kinase, which uses
the tetrapeptide KRRR of NLS3 as its recognition site
for the sequential phosphorylation of the 5 serine residues
in the C-terminal tail. Phosphatase 1, which sequentially
dephosphorylates the serine phosphates, must also have access to the S6 tail. Although this S6 C-terminal region is
unstructured similar to the terminal extension of prokaryotic ribosomal proteins, this domain cannot anchor S6 to
the 18S rRNA because it is easily cleaved off by trypsin
(Wettenhall and Cohen 1982). The last 13 amino acids
at the C-terminus of human S6, which are absent in the
S6e members of fungi, cannot be involved in stabilizing
the S6 binding to the 18S rRNA because the C-tail has
to remain flexible to allow for enzymatic interactions.
et al. (1998) have identified a single Nobis in human S7
containing a high percentage of basic amino acids that is
built from 2 clusters, which are evolutionary highly conserved, analogous to S6. In human S19, 2 short nucleolar
binding sequences have been characterized: 1 located at the
N-terminus and the other at the C-terminus (Da Costa et al.
2003). A single amino acid exchange in either Nobis fails to
localize S19 in the nucleolus and leads to Diamond–Blackfan anemia (DBA). The C-terminal Nobis of S19 is inserted
between 2 glycine residues similar to Nobis1 of S6. The
mutations in S19 of DBA patients clearly demonstrate
the importance of proper localization of ribosomal proteins
for the development of a healthy organism.
Ribosomal proteins of the large subunit also contain
evolutionary highly conserved nucleolar binding sequences
as exemplified by human L22 (Shu-Nu et al. 2000) and rat
L31 (Quaye et al. 1996), which are 6 and 5 residues long,
respectively, whereas human L5 (Rosorius et al. 2000) displays 2 nucleolar binding sequences, both of which have an
integrated NLS (table 3).
Supplementary Material
Supplementary table S1 and figures S1–S4 are available at Molecular Biology and Evolution online (http://
www.mbe.oxfordjournals.org/).
Acknowledgments
Evolutionary Highly Conserved Nucleolar Binding
Sequences Occur in Numerous Ribosomal Proteins
Our detailed analyses clearly show that the nucleolar
binding sequences of S6 reside in evolutionary highly conserved peptide clusters (fig. 5 and supplementary fig. S3,
Supplementary Material online). Does this observation also
hold true for the nucleolar binding sequences of other ribosomal proteins that have been published? Our conclusion is
corroborated by the 2 publications (Kubota et al. 1999;
Timmers et al. 1999) that delineated a single Nobis of yeast
and human S25, respectively, which consist of a highly
conserved cluster that has been maintained over more than
1 billion years of evolution (table 3 and supplementary
fig. S4, Supplementary Material online). Previously, Annilo
We thank Antonie Kruppa for her critical reading of
the manuscript and her valuable suggestions.
Literature Cited
Andersen JS, Lam YW, Leung AK, Ong SE, Lyon CE,
Lamond AI, Mann M. 2005. Nucleolar proteome dynamics.
Nature. 433:77–83.
Andersen JS, Lyon CE, Fox AH, Leung AKL, Lam YW,
Steen H, Mann M, Lamond AI. 2002. Directed proteomic
analysis of the human nucleolus. Curr Biol. 12:1–12.
Annilo T, Karis A, Hoth S, Rikk T, Kruppa J, Metspalu A. 1998.
Nuclear import and nucleolar accumulation of the human
ribosomal protein S7 depends on both a minimal nuclear
Nucleolar Accumulation of Ribosomal Protein S6 589
localization sequence and an adjacent basic region. Biochem
Biophys Res Commun. 249:759–766.
Bernstein KA, Bleicherst F, Bean JM, Cross FR, Baserga SJ.
2007. Ribosome biogenesis is sensed at the start cell cycle
checkpoint. Mol Biol Cell. 18:953–964.
Bernstein KA, Gallagher JE, Mitchell BM, Granneman S,
Baserga SJ. 2004. The small-subunit processome is a ribosome
assembly intermediate. Eukaryot Cell. 3:1619–1626.
Bommer UA, Noll F, Lutsch G, Bielka H. 1980. Immunochemical detection of proteins in the small subunit of rat liver
ribosomes involved in binding of the ternary initiation
complex. FEBS Lett. 111:171–174.
Brodersen DE, Clemons WM Jr, Carter AP, Wimberly BT,
Ramakrishnan V. 2002. Crystal structure of the 30 S
ribosomal subunit from Thermus thermophilus: structure of
the proteins and their interactions with 16 S RNA. J Mol Biol.
316:725–768.
Carmo-Fonseca M, Mendes-Soares L, Campos I. 2000. To be or
not to be in the nucleolus. Nat Cell Biol. 2:E107–E112.
Chelsky D, Ralph R, Jonak G. 1989. Sequence requirements for
synthetic peptide-mediated translocation to the nucleus. Mol
Cell Biol. 9:2487–2492.
Chen D, Huang S. 2001. Nucleolar components involved in
ribosome biogenesis cycle between the nucleolus and
nucleoplasm in interphase cells. J Cell Biol. 153:169–176.
Claussen M, Rudt F, Pieler T. 1999. Functional modules in ribosomal
protein L5 for ribonucleoprotein complex formation and
nucleocytoplasmic transport. J Biol Chem. 274:33951–33958.
Crooks GE, Hon G, Chandonia JM, Brenner SE. 2004. WebLogo:
a sequence logo generator. Genome Res. 14:1188–1190.
Da Costa L, Tchernia G, Gascard P, Lo A, Meerpohl J,
Niemeyer C, Chassis JA, Fixler J, Mohandas N. 2003.
Nucleolar localization of RPS19 protein in normal cells
and mislocalization due to mutations in the nucleolar
localization signals in 2 Diamond-Blackfan anemia patients:
potential insights into pathophysiology. Blood. 101:5039–5045.
Dingwall C, Laskey RA. 1991. Nuclear targeting sequences—a
consensus? Trends Biochem Sci. 16:478–481.
Ferreira-Cerca S, Pöll G, Gleizes PE, Tschochner H, Milkereit P.
2005. Roles of eukaryotic ribosomal proteins in maturation
and transport of pre-18S rRNA and ribosome function. Mol
Cell. 20:263–275.
Fontes MRM, The T, Jans D, Brinkworth RI, Kobe B. 2003.
Structural basis for the specificity of bipartite nuclear
localization sequence binding by importin-alpha. J Biol
Chem. 278:27981–27987.
Fromont-Racine M, Senger B, Saveanu C, Fasiolo F. 2003.
Ribosome assembly in eukaryotes. Gene. 313:17–42.
Fukami-Kobayashi K, Minezaki Y, Tateno Y, Nishikawa K.
2007. A tree of life based on protein domain organizations.
Mol Biol Evol. 24:1181–1189.
Gavin AC, Aloy P, Grandi P, et al. 2006. (32 co-authors).
Proteome survey reveals modularity of the yeast cell
machinery. Nature. 440:631–636.
Gerbi SA, Borovjan AV, Lange TS. 2003. The nucleolus: a site
of ribonucleoprotein maturation. Curr Opin Cell Biol.
15:318–325.
Grandi P, Rybin V, Bassler J, et al. (12 co-authors). 2002. 90S
pre-ribosomes include the 35S pre-rRNA, the U3 snoRNP,
and 40S subunit processing factors but predominantly lack
60S synthesis factors. Mol Cell. 10:105–115.
Granneman S, Vogelzangs J, Lührmann R, van Venrooij WJ,
Pruijn GJ, Watkins NJ. 2004. Role of pre-rRNA base pairing
and 80S complex formation in subnucleolar localization of U3
snoRNP. Mol Cell Biol. 24:8600–8610.
Hadijolov AA. 1985. The nucleolus and ribosome biogenesis.
Wien (Austria): Springer Verlag.
Hatanaka M. 1990. Discovery of the nucleolar targeting signal.
Bioessays. 12:143–148.
Hinsby AM, Kiemer L, Karlberg EO, Lage K, Fausbøll A,
Juncker AS, Andersen JS, Mann M, Brunak S. 2006. A wiring
of the human nucleolus. Mol Cell. 22:285–295.
Jäkel S, Görlich D. 1998. Importin beta, transportin, RanBP5 and
RanBP7 mediate nuclear import of ribosomal proteins in
mammalian cells. EMBO J. 17:4491–4502.
Jans DA, Xiao CY, Lam MHC. 2000. Nuclear targeting signal
recognition: a key control point in nuclear transport?
Bioessays. 22:532–544.
Katahira R, Flotow H, Thomas G, Nosaka AY. 1996. Solution
structure of the phosphorylated sites of ribosomal protein S6 by
1
H NMR spectroscopy. Int J Pept Protein Res. 47:282–288.
Klein DJ, Moore PB, Steitz TA. 2004. The roles of ribosomal
protein in the structure assembly, and evolution of the large
ribosomal subunit. J Mol Biol. 340:141–177.
Koberna K, Malinsky J, Pliss A, Masata M, Vecerova J,
Fialova M, Bednar J, Raska I. 2002. Ribosomal genes in
focus: new transcripts label the dense fibrillar components and
form clusters indicative of ‘‘Christmas trees’’ in situ. J Cell
Biol. 157:743–748.
Krüger T, Zentgraf H, Scheer U. 2007. Intranucleolar sites of
ribosome biogenesis defined by the localization of early
binding ribosomal proteins. J Cell Biol. 177:573–578.
Kubota S, Copeland TD, Pomerantz RJ. 1999. Nuclear and
nucleolar targeting of human ribosomal protein S25: common
features shared with HIV-1 regulatory proteins. Oncogene.
18:1503–1514.
Lecompte O, Ripp R, Thierry JC, Moras D, Poch O. 2002.
Comparative analysis of ribosomal proteins in complete
genomes: an example of reductive evolution at the domain
scale. Nucleic Acids Res. 30:5382–5390.
Leung AKL, Andersen JS, Mann M, Lamond AI. 2003. Bioinformatic analysis of the nucleolus. Biochem J. 376:553–569.
Lipsius E, Walter K, Leicher T, Phlippen W, Bisotti MA,
Kruppa J. 2005. Evolutionary conservation of nuclear and
nucleolar targeting sequences in yeast ribosomal protein S6A.
Biochem Biophys Res Commun. 333:1353–1360.
Mayer C, Grummt I. 2006. Ribosome biogenesis and cell growth:
mTOR coordinates transcription by all three classes of nuclear
RNA polymerases. Oncogene. 25:6384–6391.
Mears JA, Connone JJ, Stagg SM, Gutell RR, Agrawal RK,
Harvey SC. 2002. Modeling a minimal ribosome based on
comparative sequence analysis. J Mol Biol. 321:215–234.
Milkereit P, Kühn H, Gas N, Tschochner H. 2003. The preribosomal network. Nucleic Acids Res. 31:799–804.
Noller HF. 1991. Ribosomal RNA and translation. Annu Rev
Biochem. 60:191–227.
Quaye IKE, Toku S, Tanaka T. 1996. Sequence requirement for
nucleolar localization of rat ribosomal protein L31. Eur J Cell
Biol. 69:151–155.
Ramakrishnan V, Moore PB. 2001. Atomic structure at last: the
ribosome in 2000. Curr Opin Struct Biol. 11:144–154.
Raska I, Shaw PJ, Cmarko D. 2006. Structure and function of the
nucleolus in the spotlight. Curr Opin Cell Biol. 18:325–334.
Reguly T, Breitkretz A, Boucher R, et al. (20 co-authors). 2006.
Comprehensive curation and analysis of global interaction
networks in Saccharomyces cerevisiae. J Biol. 5:11.
Rosorius O, Fries B, Stauber RH, Hirschmann N, Bevec D, Hauber J.
2000. Human ribosomal protein L5 contains defined nuclear
localization and export signals. J Biol Chem. 275:12061–12068.
Russo G, Ricciarelli G, Pietropaolo C. 1997. Different domains
cooperate to target the human ribosomal L7a protein to the
nucleus and to the nucleoli. J Biol Chem. 272:5229–5235.
Ruvinsky I, Sharon N, Lerer T, Cohen H, Stolovich-Rain M,
Nir T, Dor Y, Zisman P, Meyuhas O. 2005. Ribosomal
590 Kundu-Michalik et al.
protein S6 phosphorylation is a determinant of cell size and
glucose homeostasis. Genes Dev. 19:2199–2211.
Ruvinsky I, Meyuhas O. 2006. Ribosomal protein phosphorylation: from protein synthesis to cell size. Trends Biochem Sci.
31:342–348.
Scheer U, Hock R. 1999. Structure and function of the nucleolus.
Curr Opin Cell Biol. 11:385–390.
Scherl A, Coute Y, Deon C, Calle A, Kindbeiter K, Sanchez JC,
Grecio A, Hochstrasser D, Diat JJ. 2002. Functional
proteomic analysis of human nucleolus. Mol Biol Cell.
13:4100–4109.
Schmidt C, Lipsius E, Kruppa J. 1995. Nuclear and nucleolar
targeting of human ribosomal protein S6. Mol Biol Cell.
6:1875–1885.
Schneider TD, Stephens RM. 1990. Sequence logos: a new way to
display consensus sequences. Nucleic Acids Res. 18:6097–6100.
Schuwirth BS, Borovinskaya MA, Hau CW, Zhang W, VilaSanjurjo A, Holton JM, Cate JH. 2005. Structures of the
bacterial ribosome at 3.5 Å resolution. Science. 310:793–795.
Shu-Nu C, Lin CH, Lin A. 2000. An acidic amino acid cluster
regulates the nucleolar localization and ribosome assembly of
human ribosomal protein L22. FEBS Lett. 484:22–28.
Takahashi N, Yanagida M, Fujiyama S, Hayano T, Isobe T.
2003. Proteomic snapshot analyses of preribosomal ribonucleoprotein complexes formed at various stages of ribosome
biogenesis in yeast and mammalian cells. Mass Spectrom
Rev. 22:287–317.
Timmers AC, Stuger R, Schaap PJ, van’t Riet J, Raué HA. 1999.
Nuclear and nucleolar localization of Saccharomyces cerevi-
siae ribosomal proteins S22 and S25. FEBS Lett.
452:335–340.
Tschochner H, Hurt E. 2003. Pre-ribosomes on the road from the
nucleolus to the cytoplasm. Trends Cell Biol. 13:255–263.
Uchiumi T, Kikuchi M, Ogata K. 1986. Cross-linking study on
protein neighborhoods at the subunit interface of rat liver
ribosomes with 2-iminothiolane. J Biol Chem. 261:9663–9667.
Venema J, Tollervey D. 1999. Ribosome synthesis in Saccharomyces cerevisiae. Annu Rev Genet. 33:261–311.
Volarevic S, Thomas G. 2001. Role of S6 phosphorylation and
S6 kinase in cell growth. Prog Nucleic Acid Res Mol Biol.
65:101–127.
Wettenhall RE, Cohen P. 1982. Isolation and characterization of
cyclic AMP-dependent phosphorylation sites from rat liver
ribosomal protein S6. FEBS Lett. 140:263–269.
Wool IG, Chan YL, Glück A. 1995. Structure and evolution of
mammalian ribosomal proteins. Biochem Cell Biol.
73:933–947.
Wool IG, Stöffler G. 1974. Structure and function of eukaryotic
ribosomes. In: Nomura M, Tissières A, Lengyel P, editors.
Ribosomes. Cold Spring Harbor (NY): Cold Spring Harbor
Laboratory. p. 417–460.
Wool IG, Stöffler G. 1976. Determination of the size of the pool
of free ribosomal proteins in rat liver cytoplasm. J Mol Biol.
108:201–218.
Manolo Gouy, Associate Editor
Accepted December 28, 2007