Download Dicot and monocot plants differ in retinoblastoma

Journal of Experimental Botany, Vol. 58, No. 7, pp. 1663–1675, 2007
doi:10.1093/jxb/erm022 Advance Access publication 26 March, 2007
RESEARCH PAPER
Dicot and monocot plants differ in retinoblastoma-related
protein subfamilies
Ágnes Lendvai, Aladár Pettkó-Szandtner, Éva Csordás-Tóth, Pál Miskolczi, Gábor V. Horváth,
János Györgyey and Dénes Dudits*
Institute of Plant Biology, Biological Research Center, Hungarian Academy of Sciences, Szeged, H-6726,
Temesvári krt. 62, Hungary
Received 24 August 2006; Revised 16 January 2007; Accepted 22 January 2007
Abstract
The present study supports the view that the retinoblastoma functions are shared by two distinct retinoblastoma-related (RBR) protein subfamilies in the
monocot cereal species, whereas dicot plants have
only a single RBR protein. Genes encoding RBR
proteins were identified and characterized in alfalfa
(Medicago sativa), rice (Oryza sativa), and wheat
(Triticum aestivum). The alfalfa MsRBR gene encodes
a new member of the dicot RBR proteins (subfamily A).
A comparison was made of two rice genes, OsRBR1
(subfamily B) and OsRBR2 (subfamily C), which exhibit differences in exon–intron organization and share
only 52% amino acid sequence identity. The plant RBR
proteins can be categorized into three distinct subfamilies, in which the similarity between members is
greater than the similarity to other RBR proteins from
the same species. Comparison of the transcript levels
in various tissues revealed that the expression of the
OsRBR1 gene was high in embryos or cultured cells
and gradually decreased from the basal region to the
tip of the leaves. The OsRBR2 gene displayed more
transcripts in differentiated tissues, such as leaves
and roots. In contrast, the mRNA level of the MsRBR
gene did not differ significantly in either mature leaves
or cultured cells. The results of yeast two-hybrid
pairwise interaction assays demonstrated differences
between the rice RBR variants in the interactions with
the phosphatase 2A B$ regulatory subunit and an
unknown protein. The in silico and functional data
presented in this work highlight considerable differences between dicot and monocot species in the
retinoblastoma regulatory pathways and permit an
improved classification of RBR proteins in higher
plants.
Key words: Alfalfa, NAC protein, protein phosphatase,
retinoblastoma, rice, wheat.
Introduction
Recent discoveries in plant cell cycle research have
supported the roles of both phylogenetically conserved
and plant-specific regulatory mechanisms in the control of
cell division. The identification of plant homologues of
retinoblastoma-related (RBR) genes and the characterization of different components of the plant retinoblastoma
(RB) pathway have demonstrated that the regulators of
cell division can be targets for evolutionary changes that
contribute to essential features in developmental strategies
or environmental responses.
In mammalian cells, pocket proteins include the RB
susceptibility gene product (pRB/p105) and the related
proteins p107 and pRB2/p130 (Lee et al., 1987; Ewen
et al., 1991; Mayol et al., 1993). These proteins have
functions in the cell cycle regulatory steps that link
cyclin–cyclin-dependent kinase (CDK)-integrated positive
and negative growth signals to E2F-DP transcription
factor activity in order to initiate or stop cell division
(Xiao et al., 2003). Pocket proteins interact with a wide
range of proteins involved in cellular differentiation and
cell cycle control, and probably act as a scaffold to facilitate
or bridge other protein–protein interactions (Weinberg,
1995; Dyson, 1998; Brehm, 1999). RB genes have been
isolated from a variety of animal species: mouse (Bernards
* To whom correspondence should be addressed. E-mail: [email protected]
Abbreviations: RBR, retinoblastoma-related protein; TC, tentative consensus.
ª The Author [2007]. Published by Oxford University Press [on behalf of the Society for Experimental Biology]. All rights reserved.
For Permissions, please e-mail: [email protected]
1664 Lendvai et al.
et al., 1989; Pertile et al., 1995; Huppi et al., 1996),
Xenopus (Destree et al., 1992), chicken (Boehmelt et al.,
1994), rat (Sawada et al., 1997), zebrafish (accession no.
AAM91029), and fruitfly (accession nos NM_080297,
NM_079648). Drosophila RBF proteins contribute to the
cell cycle control in insects (accession no. AF197059) (Du
et al., 1996).
The first plant RBR homologue in maize was identified
by the characterization of a partial maize cDNA clone
(Grafi et al., 1996). The RBR genes from Zea mays,
ZmRBR2a and ZmRBR2b (Ach et al., 1997), are partial
cDNA sequences which may represent alternative splice
variants of the ZmRBR2 gene. The degree of homology
between the proteins encoded by these ZmRBR genes is
;90%. The predicted proteins display homology to the
pocket A and B domains of the animal RBR protein
family (Grafi et al., 1996; Xie et al., 1996; Ach et al.,
1997). Recognition of the RB-binding LxCxE motif in
plant D-type cyclins (Dahl et al., 1995; Soni et al., 1995)
or in the viral replication protein RepA (Xie et al., 1995)
further strengthened the expectation that the RB pathway
may also function in plants. A set of experiments demonstrated interactions between the maize ZmRBR1 and a
variety of plant proteins such as D-type cyclins (Ach
et al., 1997; Huntley et al., 1998), other cyclins (Roudier
et al., 2000), viral proteins (Xie et al., 1996; Ach et al.,
1997; Horváth et al., 1998), E2F transcription factors
(Huntley and Murray, 1999; den Boer and Murray, 2000;
Gutiérrez et al., 2002), and chromatin-associated proteins,
e.g. histone deacetylases (Rossi and Varotto, 2002).
Similarly, as in animals, RBR proteins can be phosphorylated by cyclin–CDK complexes in plants (Nakagami
et al., 1999; Boniotti and Gutiérrez, 2001; Nakagami
et al., 2002).
Only limited data are available on the mechanisms
controlling the amounts of the RBR proteins and the
expression pattern of the RBR genes in plant organs. The
RBR protein has been shown to be synthesized both in
proliferating and in differentiated tissues (Xie et al., 1996;
Ach et al., 1997; Huntley and Murray, 1999). Developing
maize leaves exhibit a gradient of proliferating and differentiated cells. The actively dividing cells are located at
the leaf base, while the differentiated cells are formed
toward the tip and the ZmRBR protein is detected mainly
in the differentiated cells (Huntley et al., 1998).
After the discovery of the plant homologues of the RB
gene in maize, an increasing number of plant genes
encoding RBR proteins were isolated and characterized.
Plant RBR cDNAs have been cloned from the dicot
species Nicotiana tabacum (Nakagami et al., 1999),
Chenopodium rubrum (Fountain et al., 1999), Arabidopsis
thaliana (Kong et al., 2000), Pisum sativum (accession
no. BAA88690), Euphorbia esula (accession no.
AAF34803), Populus tremula3Populus tremuloides (accession no. AAT61377), and Scutellaria baicalensis
(accession no. AB2051361), and from the monocot Cocos
nucifera (accession no. AAM77469).
A striking degree of conservation exists in terms of the
domain organization of the RB family members, including animal and plant species (Durfee et al., 2000). The
conservation of RBR proteins over the A and B pocket
domains raised the possibility that their function might
also be conserved at the molecular level. Furthermore,
the order of the conserved domains is similar in all RB
proteins identified. The N-termini of RB proteins are
highly variable in length and sequence, which may
determine the specificity of these regulatory proteins.
Recent studies on plant cell division have discussed the
significance of the presence of several RBR genes in
maize (Sabelli et al., 2005; Sabelli and Larkins, 2006). In
the present study, the comparative analysis of the RBR
protein family was extended to monocots and dicots. The
full-length cDNA sequence of a Medicago RBR gene and
two RBR homologues in rice and wheat is reported. The
data presented on the gene structure, the gene expression,
and the comparison of amino acid sequences and interactors support the conclusion that two distinct plant RBR
proteins function in monocot Gramineae species, while
the dicots have only a single gene encoding the RBR
protein, as is indicated by the complete genome sequences
of Arabidopsis and Medicago.
Materials and methods
Cloning of the Medicago sativa RBR gene (MsRBR)
To clone the MsRBR gene, a 305 bp PCR fragment was used which
was obtained by amplification of a kZAPII cDNA library using the
following primer combination: forward primer 5#-TCCAAGTTGTACTATAGG-3#, and reverse primer 5#-TGCCATGCTTTCCAAAAG-3#. The primers were designed on the basis of the
conserved A domain part of the published ZmRBR2a sequence
(Grafi et al., 1996). The kZAPII cDNA library was constructed
from the mRNA of 3- to 4-d-old non-nitrogen-fixing nodules of
Medicago sativa ssp. varia (Savouré et al., 1995), kindly provided
by Dr Éva Kondorosi (Institut des Sciences Végétales, CNRS,
Gif-sur-Yvette Cedex, France).
Cloning of two Oryza sativa RBR genes (OsRBRs)
For isolation of the rice RBR genes, a 1521 bp long MsRBR probe
was used, which contained the conserved B domain and the
C-terminal region of the MsRBR. A PCR-based cDNA library was
prepared by using the SMARTTM cDNA Library Synthesis Kit
(CLONTECH), and was kindly provided by Crop Design NV
(Ghent, Belgium). The positive clones were selected and sequenced.
The cDNA library screen resulted in retrieval of the OsRBR1
(accession no. AY941774) and OsRBR2 (accession no. AY941775)
genes. Templates for sequencing were constructed by subcloning.
Identification of Triticum aestivum RBR genes (TaRBR1 and
TaRBR2)
The rice OsRBR1 and OsRBR2 protein sequences were used in
a TBLASTN search of the TIGR (http://www.tigr.org/tigr-scripts/
Complexity of the plant RBR pathway 1665
tgi/T_index.cgi?species¼wheat) wheat (Triticum aestivum) database. TCs (tentative consensus sequences) (TC52591, TC44330,
TC39220, TC52174, and TC46259) with significant similarity were
found. The remaining sequence of the TaRBR1 and TaRBR2
cDNAs was obtained with the PCR primers TaRBR1F (forward
5#-GAATTCGGCACGAGGCAGGCAGAGT-3#), TaRBR1R (reverse 5#-CAATTAAAACAAGGTGAAGTTTTACCCCACTGC-3#),
TaRBR2F (forward 5#-GTTTTCATTCAAATTTTGAGAAGTT-3#),
and TaRBR2R (reverse 5#-GCAGGATCGGAAGAGGCAGGGACAC-3#), after which the amplified fragments were sequenced.
Sequence alignment; phylogenetic analysis
TBLASTT analysis of the available genomic sequences was carried
out to identify the exon–intron organization of the examined RBR
genes, and the STRECHER program (http://bioweb.pasteur.fr/
seqanal/interfaces/stretcher.html) was used to identify the borders.
The regions containing RBR-like protein sequences from the A
pocket domain up to the C-terminus were aligned by using
ClustalW (http://bioweb.pasteur.fr/seqanal/ClustalW.php). The alignment was submitted to the PHYLIP server (http://bioweb.pasteur.fr/
seqanal/phylogeny/phylip-uk.html) (Felsenstein, 2002). The protpars feature was used with bootstrapping performed before analysis.
The consensus tree was then displayed with bootstrap values.
RNA extraction and real-time RT-PCR
Leaves (10 cm long) from 2-week-old seedlings and 30 cm
expanded leaves were collected from rice plants grown in the
greenhouse. The tissues were frozen in liquid nitrogen and stored
at –80 C before RNA extraction. Total RNA was isolated by
using the TRI Reagent method (Chomczynski and Sacchi, 1987)
optimized for plant RNA extraction. RNA was quantified by means
of spectrophotometric OD260 measurements, and the quality was
assessed by calculating the ratio OD260/OD280 and by electrophoresis on a 1% formaldehyde agarose gel followed by ethidium
bromide staining. RNA samples were stored at –80 C.
Two-step real-time reverse transcription (RT)-PCR was performed. First-strand cDNA was synthesized from 1 lg of total
RNA, using the M-MuLV H minus reverse transcriptase system
(Fermentas, Vilnius, Lithuania) with random hexamer primers,
according to the manufacturer’s instructions. The cDNAs were
diluted 1:3.5 with nuclease-free water. Aliquots of the same cDNA
sample were used for all primer sets during real-time PCR, and
amplification reactions were performed with all primer sets during
the same PCR run. Gene-specific primers were designed for the
sequences corresponding to the N-terminal regions of RB proteins.
The specific primer pair (forward 5#CTCGTCAGGCTTAGATGTGCTAGAT-3#, reverse 5#TGAACAATGCTGAGGGATTCAA-3#) for the rice actin 1 gene (accession no. X63830) was used
as internal control. In the case of alfalfa, the actin gene was also
used as internal control. The specific primers for the examined
genes were: MsRBR (forward 5#CCCAAGCCTTCCTGACATGT3#, reverse 5#TTGGATGACCGTAATGGAGAGA-3#); OsRBR1
(forward
5#CTCCTATCCAGCATGTCATCCTT-3#,
reverse
5#AGCCTTGACACACAGTAAAGAACAA-3#); and OsRBR2
(forward 5#TGGCCCCTCCGTGTGA-3#, reverse 5# TGACGCCATGAAAGAGCTACA-3#). Each oligonucleotide hybridized specifically with cDNAs and produced correctly sized PCR fragments.
Specific primers for actin cDNA were used as internal control for
real-time PCR in all tested species. Reactions were carried out in
a volume of 20 ll containing 150 nM of each primer, 7 ll of
cDNA sample (derived from 40 ng of input total RNA). and 10 ll
of 23 SYBR Green PCR Master Mix (Applied Biosystems, Foster
City, CA, USA). Real-time PCR was performed on the ABI Prism
7000 Sequence Detection System (Applied Biosystems) in a 96-
well reaction plate, using the parameters recommended by the
manufacturer (10 min at 95 C and 45 cycles of 95 C for 15 s and
60 C for 1 min). Each PCR was performed in triplicate, and notemplate controls were included. The specificity of the amplifications was verified at the end of the PCR run, using ABI Prism
Dissociation Curve Analysis Software. The efficiencies of the
amplicons were analysed by a standard curve method. Two
independent experiments were performed, including reverse transcription and real-time PCR steps. The 2–DDCt method was used to
analyse the real-time PCR data (Livak and Schmittgen, 2001). The
expression of the examined genes was normalized to the endogenous control, in this case to the rice and Medicago actin genes, to
compare the expression levels relative to a calibrator sample, i.e. the
mature leaf tip; the DCt for the mature leaf tip was subtracted from
the DCt for each sample. The expression level was also normalized
with the aid of an absolute quantification method based on the
standard curve, using a known amount of template DNA during
real-time PCR detection (Rutledge and Cote, 2003). The relative
expression values matched the expression values observed during
use of the 2–DDCt method.
Yeast two-hybrid matrix analysis
For yeast two-hybrid experiments, the vector constructs pGBT9/
MsRBR, pBD-GAL4 2.1/OsRBR1, and pBD-GAL4 2.1/OsRBR2
were used as bait, and pAD-GAL4 2.1/MSV RepA (Horváth et al.,
1998), pAD-GAL4 2.1/OsRBRI2 (unpublished results), pAD-GAL4
2.1/OsRBRI5 (unpublished results), pAD-GAL4 2.1/Medtr;CycD5
(unpublished results), and pAD-GAL4 2.1/MsPP2AregB (unpublished results) were used as prey. The cloning vectors pGBT9,
pBD-GAL4 2.1, and pAD-GAL4 2.1 were obtained from Clontech
and Stratagene (La Jolla, CA, USA). The Saccharomyces cerevisiae
yeast strain PJ69-4a (James et al., 1996) was transformed with the
appropriate constructs, as performed by Schiestl and Gietz (1989).
The transformants were grown on a –Trp, –Leu, –His, –Ade medium,
with monitoring of the activation of the HIS3 and ADE2 reporter
genes. The protein association strength was quantified with the ONPG
(o-nitrophenyl-D-galactopyranoside) method. Relative b-galactosidase
units were determined according to Horváth et al. (1998).
Results
Identification of RBR genes in alfalfa, rice, and wheat
Various primer combinations were designed and tested for
PCR amplification of the RBR gene from M. sativa, on the
basis of the published sequence information on the maize
RBR gene. The PCR product was sequenced and used for
the screening of a cDNA library. Following this approach,
a full-length cDNA MsRBR was obtained which was
3559 bp long; and the encoded protein consisted of 1025
amino acids, with a calculated molecular mass of 114 kDa
and a pI of 7.6 (Table 1). Alignment of the predicted
amino acid sequence of MsRBR with several members of
the RBR protein family revealed reliable homology,
especially in the A and B pocket domains (Fig. 1).
MsRBR shares 67–91% amino acid sequence identity
with full-length dicot RBR sequences.
Two rice RBR genes were also isolated via a rice cDNA
library screen, using the coding region of the Medicago
RBR gene. Analysis of the full 3498 bp OsRBR1 sequence
demonstrated that this cDNA encodes a protein of 1010
1666 Lendvai et al.
Table 1. List of plant RBR proteins and their basic characteristics (GenBank accession and protein identification number,
predicted molecular size and mass, isoelectric point)
AtRBR
CrRBR
CnRBR
EeRBR
MsRBR
NbRBR
NtRBR
OsRBR1
OsRBR2
PsRBR
PtRBR
SbRBR
TaRBR1
TaRBR2
ZmRBR1
ZmRBR2
ZmRBR2a
ZmRBR2b
ZmRBR3
Accession
number
Protein ID
AF245395
CRU011681
AY117036
AF230739
AY941773
AY699399
AAF79146.1 1013
CAA09736.1 1012
AAM77469 1011
AAF34803.1 801
1025
1003
AAU05979
961
1010
987
BAA88690.1 1026
AAT61377 1035
1006
957
598
CAA67422
867
CAC82493
866
AAB69650
420
AAB69651
584
AAZ99092.1 1010
AY941774
AY941775
AB012024
AF133675
AB205136
AY941772
AY941776
X98923
AJ279062
AF007794
AF007795
DQ124423
Size
Molecular pI
(amino acids) mass (kDa)
112.2
112.9
112.3
88.7
114.2
111.6
106.6
111.6
107.9
114.5
114.6
111.8
106.1
7.8
7.6
8.1
8.4
7.6
8.1
7.8
8.6
8.1
7.5
8.2
8.3
8.5
96.3
96.5
7.8
7.9
111.4
8.7
At, Arabidopsis thaliana; Cr, Chenopodium rubrum; Cn, Cocus
nucifera; Ee, Euphorbia esula; Ms, Medicago sativa; Nb, Nicotiana
benthamiana; Nt, Nicotiana tabacum; Os, Oryza sativa; Ps, Pisum
sativum; Pt, Populus termula3Populus tremuloides; Sb, Scutellaria
baicalensis; Ta, Triticum aestivum; Zm, Zea mays
amino acids with a molecular weight of 111.5 kDa and
a pI of 8.65. OsRBR1 shares 52–85% identity at the
amino acid level with full-length plant RBR proteins. By
further cDNA library screening, another rice RBR variant,
OsRBR2, was identified. The nucleotide sequence of the
OsRBR2 gene displayed only 52% identity to OsRBR1.
The full-length OsRBR2 cDNA clone was 3383 bp long
and encoded a polypeptide of 978 amino acids with
a calculated molecular weight of 107.9 kDa and a pI of
8.10. The OsRBR1 and OsRBR2 proteins share 52%
identity in amino acid sequence, which indicates the
presence of two distinct RBR proteins and coding genes
in rice that belong in different classes of RBR proteins
characteristic for the monocot species, as shown in Figs 1
and 3.
Database homology searches were used to identify other
monocot orthologous counterparts. The known sequence
data on the RBR proteins from rice were used as queries
to perform TBLASTN searches against the available
wheat expressed sequence tag (EST) database. The partial
sequence information on the identified TCs helped in the
isolation of RBR genes from wheat by PCR amplification
and sequencing of cDNAs. Analysis of the 3446 bp
sequence from TaRBR1 indicated that the full-length
sequence encodes a protein of 957 amino acids with a
calculated molecular mass of 106.1 kDa, while the identified partial TaRBR2 cDNA was 1890 bp and the partial
encoded protein contained 598 amino acids (Table 1). The
wheat RBR proteins share identical amino acids to an
extent of 58%. This low level of homology reflects the
presence of two distinct classes of RBR genes in this
Gramineae species. Specific motifs of conserved regions
can be recognized in the protein alignment (Fig. 1).
Exon–intron organization of plant RBR genes
The availability of the A. thaliana and rice genome
sequences allowed comparisons of the structures of
selected dicot and monocot RBR genes. The RBR gene in
Arabidopsis was identified by searching the TAIR
database (Kong et al., 2000). The chromosomal location
of each RBR gene was determined by using different databases: the rice physical map (Chen et al., 2002), the genomic sequences of Arabidopsis (http://www.arabidopsis.
org), and the available Medicago BAC (bacterial artificial
chromosome) sequences (http://www.genome.ou.edu/
MtBACs.html). It was established that OsRBR1 mapped
to chromosome 8 (BAC clone: Osch8 P0666G10), and
that OsRBR2 was located on chromosome 11 (BAC clone:
Osch11 OsJNBa0080108). Figure 2 shows the exon–
intron boundaries and the location of the A and B pocket
domains in Arabidopsis (AtRBR), Medicago (MsRBR),
and rice OsRBR1 and OsRBR2 genes. Three of the
analysed RBR genes contain 18 exons in the approximately 8000 bp long DNA fragments. In the case of
MsRBR, one intron is missing, and exon 14 is therefore as
long as AtRBR exons 14 and 15. The presence of conserved RB domains is common to all plant RBR genes.
The analysis of the positions of sequence domains
revealed that the highly conserved coding region of the
A pocket domain was located on exon 10 for all plant
RB-like genes, the following exon (11) encoding the
spacer region. In all examined plant RBR genes, the
B pocket domains are coded by the next four exons. The
intron between exons 10 and 11 in the rice OsRBR2 gene
was longer than in other RBR genes. The OsRBR1 gene
exhibits considerable similarity in exon–intron structures
to the AtRBR gene; and their introns are located at similar
positions within the coding regions (Fig. 2).
Comparative phylogenetic analysis of the
plant RBR proteins
To investigate the relationships between known members
of the RBR protein family from different plant species,
phylogenetic analyses were carried out on deduced protein
sequences. Table 1 lists previously characterized plant
RBR proteins, with the name, the number of amino acid
residues, the molecular mass, and the pI value. The
published partial RBR protein sequences from maize
(ZmRBR2a and ZmRBR2b) can represent alternatively
spliced variants of ZmRBR2 (Grafi et al., 1996). Furthermore, ZmRBR1 and ZmRBR2 are differentially spliced
transcripts, the homology between these ZmRBR proteins
being higher than 90%.
Complexity of the plant RBR pathway 1667
Fig. 1. Alignment of selected plant RBR protein sequences. The alignment of amino acid sequences shown from A pocket domains to the C-termini.
Identical residues are highlighted by a black background. The pocket domains are indicated. Asterisks denote consensus residues, while dots
symbolize similar residues. The RBR families are indicated on the left side of the alignment.
The ClustalW method was used for alignment to
classify various representatives of RBR proteins from
diverse plant species. As the phylogenetic tree created by
the PHYLIP method shows, the plant RBR proteins can
be categorized into three distinct subfamilies (Fig. 3).
Subfamily A contains all dicot RBR proteins, such
as AtRBR, EeRBR CrRBR, MsRBR, NtRBR, PtRBR,
and PsRBR, while subfamilies B and C comprise different monocot RBR proteins. The phylogenetic tree
definitely separates members of subfamily B, including
1668 Lendvai et al.
1
2 3 4 56
7 8 9
10
1112 13141516 17 18
AtRBR
A domain
1
2 3 4 5 6
7
8 9
B domain
10
11 12
13 14 15 16 17
MsRBR
A domain
1
2 3 4 5
6 7 8 9
10
B domain
1112 13 141516 17 18
OsRBR1
A domain
1 2 3 45
6 7 8 9
B domain
10
111213
14 1516 17 18
OsRBR2
A domain
2000
B domain
4000
6000
8000
Fig. 2. Exon–intron structures of selected plant RBR genes. The AtRBR gene is located on chromosome 3 (At3g12880). The position of the MsRBR
gene is to be found on mtgsp_001a.6.fasta.screen.Contig4.comp. The OsRBR1 gene is located on chromosome 8 (Osch8P0666G10), while the
OsRBR2 gene is on chromosome 11 (Osch11 OsJNBa0080108). Boxes and lines indicate exons and introns, respectively. Arrows show the encoded
regions of the A and B pocket domains. The scale indicates the base pair length.
the OsRBR1/TaRBR1/ZmRBR3/CnRBR proteins, from
subfamily C, including the OsRBR2/TaRBR2/ZmRBR1/
ZmRBR2 proteins. The variants of the monocot RBR
proteins in subfamily C were identified as a distinct
cluster that had no counterpart in dicot species. The RBR
from the non-graminaceous monocot C. nucifera, CnRBR
(accession no. AAM77469), belongs in the monocot
subfamily B and lies near the node of the branching point
between dicots and monocots (Fig. 3). The dicot RBR
proteins share 66–91% amino acid identity within subfamily A. The monocot RBR protein sequences are 69–
85% identical in subfamily B and 74–90% identical in
subfamily C. The orthologous proteins of the different
cereal species generally exhibit greater similarity to each
other within the subfamilies than to another RBR protein
from the same species. Subfamilies A and B share
54–67% identity, while the sequences of the RBR proteins
in subfamily C are 48–60% identical to those in the dicot
subfamily A. The two distinct monocot subfamilies B and
C share 48–59% amino acid identity. The present description of the subfamilies of plant RBR proteins reveals
a phylogenetic separation between the known monocot
RBR proteins, indicating a more complex RB pathway in
the monocot cereal species. The phylogenetic tree presented in Fig. 3 suggest a closer relationship between the
dicot RBR proteins (subfamily A) and monocot subfamily
B proteins than between the subfamily C RBR proteins
and the dicot representatives. The similarities and differences between the RBR proteins of various subfamilies
will be discussed later.
Subfamily A
NtRBR
NbRBR
SbRBR
PtRBR EeRBR
PsRBR
MsRBR
AtRBR
CrRBR
ZmRBR1
ZmRBR2ap
ZmRBR2bp
Subfamily C
OsRBR2
TaRBR2p
CnRBR
TaRBR1
ZmRBR3
OsRBR1
Subfamily B
PpRBR
ChiRBR
ChrMAT3
0.1
OtRBR
Fig. 3. Phylogenetic tree of RBR from plants. The multiple alignment
was analysed by ClustalW with a bootstrapped neighbour-joining
method and displayed with the Phylodendron program (http://iubio.
bio.indiana.edu/treeapp/). The 24 analysed sequences from 16 species
reveal three RBR subfamilies. Subfamily A contains the dicot RBrelated homologues. Subfamilies B and C comprise the monocot RBR
proteins. The scale beneath the tree measures the evolutionary distance
between sequences. At, Arabidopsis thaliana; Chi, Chlamydomonas
incerta; Chr, Chlamydomonas reinhardtii; Cr, Chenopodium rubrum;
Cn, Cocos nucifera; Ee, Euphorbia esula; Ms, Medicago sativa; Nb,
Nicotiana benthamiana; Nt, Nicotiana tabacum; Os, Oryza sativa;
Ot, Ostreococcus tauri; Pp, Physcomitrella patens; Ps, Pisum
sativum; Pt; Populus tremula3Populus tremuloides; Sb, Scutellaria
baicalensis; Ta, Triticum aestivum; Zm, Zea mays.
Complexity of the plant RBR pathway 1669
Differential expression of plant RBR genes
The expression patterns of the different RBR genes in rice
and alfalfa were investigated by real-time quantitative
RT-PCR analysis of RNA samples from different tissues.
In view of the high similarity between the homologous
rice sequences, the primers were designed for the less
homologous 5# regions, allowing specific amplification of
the target genes.
Growing young rice leaves measuring 1061 cm were
cut into four sections, and six regions were cut from
expanded rice leaves measuring 3063 cm. In the case of
alfalfa, three regions were cut from mature leaves. Figure 4
presents the relative mRNA amounts normalized to the
actin RNA levels. Figure 4A shows the expression levels
of the two rice RBR genes, which differ significantly in
the various organs. The OsRBR2 transcripts were found to
10
1
0.1
0.01
0.001
1.p 2.p 3.p 4.p 5.p 6.p
YOUNG RICE LEAF
MATURE RICE LEAF
10
OsRBR1
OsRBR2
1
MsRBR
0.1
0.01
3.p
ce
2.p
d
1.p
cu
MATURE Medicago LEAF
ot
0.0001
lls
0.001
ro
Relative mRNA level in log scale
B
1.p 2.p 3.p 4.p
7D
A
21 F e
m
D
br
A
F
em y o
br
yo
pa
ni
cl
e
st
em
cu
ro
ltu
ot
re
d
ce
lls
0.0001
ltu
re
Relative mRNA level in log scale
A
be more abundant in both the younger developing and the
fully expanded leaves. The ratio between the transcripts of
the OsRBR1 and OsRBR2 genes was dependent on the age
of the leaves. In the young leaves, the constitutively
expressed OsRBR2 gene was transcribed at a 5–10 times
higher level than the OsRBR1 gene, while in the fully
expanded leaves the OsRBR2 transcripts were present in
quantities several hundred times higher than the mRNA
levels of OsRBR1. In contrast to the OsRBR2 gene, the
expression of the OsRBR1 gene decreased from the basal
region to the tip region of the analysed leaves. This
pattern suggests that the OsRBR1 gene is more active in
the basal region of the leaves, where cell divisions are
expected to occur and cell differentiation is not complete.
In accordance with these findings, higher transcript levels
of this gene were detected in embryos and actively
Fig. 4. Relative expression levels of rice and alfalfa RBR genes. The relative transcript accumulation from the examined genes was determined by
real-time PCR and normalized to the constitutive actin gene expression levels. Transcript abundance was quantified in total RNA from sections of
young leaves, of expanded leaves, 7 DAF (day after fertilization) embryos, 21 DAF embryos, panicles, roots, and cultured cells. (A) The relative
mRNA levels of the OsRBR1 and OsRBR2 genes in rice tissues. (B) The relative transcript levels of the MsRBR gene in Medicago tissues. Different
parts (p) of leaves from the basal to the tip region are indicated with ascending numbers.
1670 Lendvai et al.
dividing cultured cells. Analyses of the transcript accumulation in the various tissues of alfalfa demonstrated that
this gene (subfamily A) was constitutively active in various sections of the mature leaves, and also in the cells of
the roots and suspension cultures (Fig. 4B). The presented
expression data reveal essential differences between the
two rice RBR gene variants expressed differentially in
various tissues, with variable ratios between dividing and
differentiated cells.
Selectivity of RBR proteins in interactions with
functional protein partners
For yeast two-hybrid interaction studies, plasmids containing the full-length sequences of MsRBR (pGBT9/
MsRBR), OsRBR1 (pBD-GAL4 2.1/OsRBR1), and
OsRBR2 (pBD-GAL4 2.1/OsRBR2) were used as bait, and
yeast strain PJ69-4A (James et al., 1996) co-transformed
with vectors carrying the rice RBR interactor partners
(OsRBRI2 and OsRBRI5), Medicago cyclin D5 (Medtr;
CycD5), Medicago protein phosphatase PP2A B$ regulatory subunit, and maize streak virus RepA (MSV RepA)
(Horváth et al., 1998) were used as prey. As shown in
Fig. 5, all three plant RBR proteins interacted with
the viral replication protein which contains the wellknown LxCxE RB-binding motif. None of them was able
to bind to the analysed Medicago D-type cyclin (Medtr;
CycD5), which lacks this motif (data not shown).
Extensive yeast two-hybrid screens, using the full-length
MsRBR protein as bait, resulted in several Medicago
truncatula interactors (encoded by sequences TC109726,
BI270584, and AW692851). One of these proteins
exhibited homology to the PP2A B$ regulatory subunit
(39% identity and 57% similarity to murine PR59 PP2A
regulatory subunit) reported by Voorhoeve et al. (1999).
Fig. 5. Yeast-two hybrid interaction studies with RBR proteins. In
order to verify the interaction of RBR proteins, the indicated bait and
prey constructs were co-transformed to yeast strain PJ69-4A and the
transformants were plated onto SD-Trp-Leu-Ade-His selective medium.
Relative b-galactosidase activities were measured according to Horváth
et al. (1998). Standard deviations were lower than 10%. OsRBRI2 is an
unknown protein while the OsRBRI5 protein belongs in the NAC
family of transcription factors *Values of relative b-galactosidase
activity.
Further pairwise assays revealed that this protein discriminated between the two rice RBR proteins in interaction
strength. The alfalfa RBR and OsRBR1 proteins underwent strong association with the PP2A B$ regulatory
subunit, while OsRBR2 failed to interact with this prey
(Fig. 5). Further yeast two-hybrid screens performed with
OsRBR1 as bait resulted in a new interacting protein,
OsRBRI2, which exhibited significantly different association strengths with the analysed dicot and monocot RBRs.
In this test, selective interactions were detected between
OsRBRI2 protein and the MsRBR and OsRBR1 proteins.
The specificity of this interactor toward only one of the
rice RBR proteins may be an indication of functional
differences between the rice RBR variants. On the basis
of sequence database searches, OsRBRI2 is an expressed
protein homologous to AK101154 (cDNA_clone_
J033027D16). Another interacting partner, the OsRBRI5
protein, displayed homology to NAC proteins (LOC_
Os02g38130, by TIGR Rice Genome Database). This
interactor contains the RB-binding motif (LxCxE), and
can therefore interact with all the analysed RBR proteins,
but differences in the strengths of the interaction were
detected. The similarity observed between the alfalfa
MsRBR and the rice OsRBR1 as concerns the preference
of the interactors can be interpreted as a sign of a closer
functional relationship between RBR subfamilies A and
B. The presented protein–protein interaction data support
the suggestion that the functional diversity of the RBR
proteins is characteristic in monocot rice.
Discussion
Since the RBR proteins are expected to play significant
roles in the control of plant growth and development, in
recent years increasing attention has been paid to the RBR
protein family of plants as molecular regulators (Durfee
et al., 2000; Gutiérrez et al., 2002; Sabelli and Larkins,
2006). The present study is focused on the identification
and initial characterization of new members of the RBR
family in plants. Five cDNAs were isolated and designated MsRBR from the model legume M. sativa, OsRBR1
and OsRBR2 from rice, and TaRBR1 and TaRBR2 from
wheat. The pocket proteins encoded by these genes
belong in the RBR protein family whose members all
share common A/B domains conserved in both animals
and plants (Fig. 1).
Gene comparisons facilitate studies on the conservation
of coding and non-coding regions and on the molecular
mechanisms of genome evolution. In the human RB
family, the RB transcripts are encoded by 27 exons, the
p107 gene is composed of 22 exons, and the RB2/p130
gene consists of 22 exons (Claudio et al., 2002). It is
evident that the p107 and RB2/p130 genes exhibit
homology in their genomic arrangement and conserved
Complexity of the plant RBR pathway 1671
protein regions, suggesting a closer evolutionary relationship between the p107 and RB2 genes. As in the human
RB family, the exon–intron arrangements of plant RBR
genes follow the observed protein similarities between the
RBR proteins. The examined plant RBR genes contain
18 exons and 17 introns, and the homologous exons are
identical in size and share high sequence identity at the
nucleotide and amino acid levels. The transcribed region
of the plant RBR genes is organized into 18 exons, and
spans about 7000 bp of genomic DNA from the transcription start to the termination site (Fig. 2). The highly
conserved coding region of the A pocket domain is
located on exon 10 in all plant RB-like genes. Overall, the
size and arrangement of the exons encoding conserved
domains appear to be typical features of the RBR genes, as
in all members of the vertebrate RB family. Analysis of
the exon–intron structure indicates that the monocot RBR
subfamily B is more closely related to the dicot genes
(subfamily A), as shown by the phylogenetic tree (Fig. 3).
The constructed phylogenetic tree presented here, which
consists of RBR proteins from 16 plant species, reveals
that the plant RBR proteins can be classified into three
subfamilies on the basis of the amino acid sequence
similarity. Sequence analysis allows the separation of two
characteristic subfamilies (subfamilies B and C) of RBR
proteins from monocot species in addition to the cluster of
dicot RBR proteins (subfamily A), as shown in Fig. 3.
The organization of the MsRBR gene and the amino acid
sequence of the encoded protein reveal that the alfalfa
RBR protein belongs in subfamily A, which includes all
known dicot RBR proteins deposited in the database to
date (Fig. 3). Previously, A. thaliana was the only higher
plant among these species known to have a RBR gene
since the Arabidopsis genome had been completely
sequenced (Seki et al., 2002). Extensive in silico studies
on EST/TC databases support the suggestion that, like
Arabidopsis, other dicot species contain a single RBR
gene. This assumption was recently verified by an analysis
of the complete genome sequence of M. truncatula
(Cannon et al., 2006). The present search identified
a single RBR gene on chromosome 8 (accession no.
AC119410) of Medicago. Within the A and B pocket
domains, the RBR proteins exhibit very high sequence
identity, which is indicative of a common ancestor. In
non-vascular plants, homologues to RBR genes have been
identified, such as the mat3 gene (AF375824) from the
unicellular green alga Chlamydomonas reinhardtii (Umen
and Goodenough, 2001), the recently cloned RB-like
(mat3) gene from Chlamydomonas incerta (AY781411),
a putative RB homologue (AJ428952) from moss (Physcomitrella patens) (http://moss.nibb.ac.jp), and the newly
reported RBR gene in Ostreococcus tauri (Robbens et al.,
2005). All these studies also suggest that RBR genes have
an ancient origin. The recognition of two cereal RBR
proteins presumes gene duplication, which is prevalent in
plants and which might lead to evolutionary innovation.
The present comparative study provides a new example
of the divergence of species belonging in the two major
angiosperm subclasses, monocots and dicots.
In the animal kingdom, the complexity of the RB
pathway is illustrated by the increasing number and
functional diversification of the RBR proteins from insects
to mammals. In insects such as Drosophila melanogaster,
two RB-like proteins (Rbf1 and Rbf2) have been
discovered and shown to have a distinct role in development (Keller et al., 2005). These gene products are
co-expressed at several stages of development and their
transcriptional induction has been linked to the mitotic
programme in the eye imaginal disc. The Rbf2 protein
level demonstrated temporal variation during embryogenesis, in contrast to the more constant levels of Rbf1
(Stevaux et al., 2002; Keller et al., 2005). The human RB
family proteins represented by three orthologues, pRB/
p105, p107, and pRB2/p130, which control the major
G1 checkpoint, promote terminal differentiation or mediate
regulation of the chromatin structure (Rossi et al., 2003),
or repress the transcription (Zhang and Dean, 2001; Ho
and Dowdy, 2002). The genes encoding the three RB
family members vary in their expression patterns in
different tissues. pRb2/p130 displays high mRNA levels
in non-proliferating cells, while p107 accumulates in cells
from the middle of G1 to mitosis. In plants, a diversification of the RBR genes and encoded proteins can be seen
only in cereal monocot species.
The present study revealed the most characteristic
differences between the two rice RBR genes in expression
patterns detected in the leaves in various developmental
stages. The transcripts of the OsRBR2 gene were detected
in all the leaf tissues analysed, indicating the constitutive
expression of this gene variant. Similarly, relatively high
amounts of OsRBR2 mRNAs were accumulated in the
root tissues. The transcript level of the OsRBR2 gene was
significantly higher than the mRNA level of the OsRBR1
gene both in the segments of young leaves and in older
rice leaves. These experimental data suggest a role for this
gene variant in terminally differentiated cells. Despite the
fact that leaf tissues consist of a variety of cell types, most
of the cells are differentiated ones, and in root explants
a majority of the cells are from the elongation zone and
are expected to be non-cycling. The transcript of the other
rice gene, OsRBR1, exhibits a different, but characteristic
distribution pattern. There is a gradual reduction of the
level of OsRBR1 mRNA from the basal section of the
leaves toward the leaf tip, especially in older leaves. In
general, 10 times more OsRBR1 mRNA is accumulated in
the younger leaves. The difference is even more significant in the basal section of the leaves. As a consequence
of their mode of development, monocotyledonous maize
leaves display a proliferative gradient from the meristematic region at the leaf basal region through a series of
1672 Lendvai et al.
progressively differentiating cells to the mature zone at the
tip, made up largely of fully differentiated cells (Granier
et al., 2000). It is presumed that rice leaves show a similar
pattern of differentiation (Barrôco et al., 2006). This was
also indicated by the previous observation that the monocot leaf is polarized in both cell division and expansion.
In monocots, a basal meristem generates files of cells
that remain aligned from the base to the tip of the leaf
(Nelson and Langdale, 1989). As concerns the developmental pattern of cereal leaves and the expression profile
of the OsRBR1 gene, a link is suggested between the
activity of this gene variant and the potential of the cells
to undergo division. It was recently demonstrated that
NbRBR suppression by VIGS exerts effects on various cell
layers at different rates (Park et al., 2005). The tissue- and
cell-specific expression of pocket proteins has also been
demonstrated in animals, and the three members of the
RB family in humans were found to differ in their expression patterns (Claudio et al., 2002). The present gene
expression data are in harmony with the suggestion that
the different transcript profiles of the two rice RBR genes
may reflect functional divergences, as in animals.
Studies on cell division in maize leaves have led to the
finding that the rate of cell division is consistently high in
the basal region of the developing leaves (Granier et al.,
2000). This part of cereal leaves can be utilized for callus
induction and plant regeneration through the reactivation
of cell division by treatment with auxin (2,4-dichlorophenoxyacetic acid) (Zamora and Scott, 1983). In developing
embryos and cultured cells, the OsRBR1 transcripts have
been found to be more abundant than those from the
counterpart OsRBR2 gene. Since these tissues are rich in
dividing cells, these data lend support to the conclusion
that the activity of the OsRBR1 gene may be related to
cell division or cell cycle progression. In the mouse,
the differential expression of RB and homologue genes
has also been demonstrated during embryogenesis (Jiang
et al., 1997). The accumulation of alfalfa gene MsRBR
transcripts did not vary significantly in the different
segments of the leaves (Fig. 4B). Similar mRNA levels
were detected in the leaves and in the rapidly dividing
cells in the suspension cultures, suggesting that the
activity of this dicot RBR gene is independent of the
actual division events occurring in the analysed tissues.
The transcript analysis of the Arabidopsis RBR gene involving use of the Genevestigator database (Zimmermann
et al., 2004) (www.genevestigator.ethz.ch) indicated
that the AtRBR is expressed constitutively in a variety
of Arabidopsis organs. A recent report on microarray
analysis, focusing on the cell cycle genes in Arabidopsis
leaf development, also showed the constitutive expression
of the AtRBR gene when cells progress from proliferation
to maturity (Beemster et al., 2005). The presented gene
expression data emphasize the divergence of the rice RBR
genes, which is a novel feature of cereal monocot species
as compared with the dicot species exhibiting a single
RBR gene, as in the case of alfalfa.
During evolution, proteins have evolved specifically to
interact with different sets of partners. Selectivity in
interactions can reflect the functional divergence of the
RBR proteins from various subfamilies. D-type cyclins
containing the LxCxE amino acid motif from a variety of
plant species have been found to interact with RBR
proteins (Huntley et al., 1998; Boniotti and Gutiérrez,
2001). In alfalfa, an A2-type cyclin interacted with the
maize ZmRBR1 protein in a yeast two-hybrid system
(Roudier et al., 2000). The interference of viral proteins
with events in the cell cycle of the host cells can be
achieved through their interactions with RBR proteins
(Gutiérrez, 2000). The present yeast two-hybrid data
(Fig. 5) indicate both similarity and diversity in the interactions between the RBR proteins from different subfamilies and various interactors. The RBR proteins from
either subfamily can associate with the LxCxE motifcontaining partners. One of these interactors is the
OsRBRI5 protein, which belongs in the plant-specific
NAC family (for NAM-ATAF-CUC-related). NAC family
genes have been reported to be involved in various
functions, such as organ development and morphogenesis,
responses to virus attack and wounding, or signal transduction, such as auxin and abscisic acid signalling (Olsen
et al., 2005). Further experiments are needed to evaluate
the functional consequences of the RBR protein–NAC
transcription factor interaction; however, it should be
noted, that among Arabidopsis and rice NAC proteins,
only the latter contains the RB-binding protein motif
(LxCxE).
The regulatory functions of RB proteins in cellular
processes depend essentially on their phosphorylation
status, which is also regulated by phosphatases PP1 and
PP2A (Yan and Mumby, 1999). The present yeast twohybrid analysis has revealed that the MtPP2A B$
regulatory subunit, as a strong interactor of MsRBR, can
also interact with the OsRBR1 protein, but there was no
detectable association with the OsRBR2 protein. A similar
situation was reported for mammalian pocket proteins.
Murine RBs were shown to interact with the PR59 PP2A
B$ regulatory subunit in a differential manner: only the
p107 protein participated in a strong association; the pRb
protein failed to form a complex (Voorhoeve et al., 1999).
The PR59-associated PP2A complex exhibited dephosphorylation activity on bound p107 in vivo, and overexpression of this phosphatase regulatory subunit in
U2-OS cells resulted in inhibition of the cell cycle progression and the arrest of cells in G1 phase (Voorhoeve
et al., 1999). As regards the selectivity in complex formation, additional support is furnished by the fact that
plant RBRs belonging in subfamilies B and C have
different roles in the regulation of plant cell division and
differentiation. This is in accord with the organization of
Complexity of the plant RBR pathway 1673
the phylogenetic tree (Fig. 3), indicating a closer relationship in structure and interactions between the RBR proteins of subfamilies A and B. However, the RBR gene
expression profiles differ in these subfamilies. The developmental regulation of RBR gene expression is limited
only to the OsRBR1 gene (subfamily B), while the MsRBR
gene (subfamily A) and the OsRBR2 gene (subfamily C)
share similarity in constitutive expression profiles. Further
studies are needed to establish evolutionary links between
the RBR proteins of different subfamilies.
The identification of two types of monocot cereal RBR
proteins with distinct features in gene organization, expression pattern, amino acid sequence identity, and interactor partners points to significant differences between
dicot and monocot species as concerns the functional role
of the RB pathway. The present report on the cloning
of RBR genes and comparison of the encoded proteins
from alfalfa, rice, and wheat extends our knowledge by
classifying the RBR proteins into three subfamilies.
Diversification of the RB functions in monocot cereals
strengthens the view of a complex RB regulatory pathway
in Gramineae. Further genetic, biochemical, and physiological studies are required for a functional characterization of the different members of the RBR protein family
in plants and for a specification of the roles of various
monocot RBR proteins.
Acknowledgements
We thank Katalin Török for technical assistance and Mátyás
Cserháti for his critical reading of the manuscript. G.V.H. is grateful
for the support of a János Bólyai Research Fellowship. The authors
are grateful to Dr David Durham for the improvement of the
English text. This work was supported by the Crop Design NV
(Ghent, Belgium).
References
Ach RA, Durfee T, Miller AB, Taranto P, Hanley-Bowdoin L,
Zambryski P, Gruissem W. 1997. RRB1 and RRB2 encode
maize retinoblastoma-related proteins that interact with a plant
D-type cyclin and geminivirus replication protein. Molecular and
Cellular Biology 17, 5077–5086.
Barrôco RM, Peres A, Droual A-M, et al. 2006. The cyclindependent kinase inhibitor Orysa;KRP1 plays an important role in
seed development of rice. Plant Physiology 142, 1053–1064.
Beemster GTS, De Veylder L, Vercruysse S, West G,
Rombaut D, Van Hummelen P, Galichet A, Gruissem W,
Inze D, Vuylsteke M. 2005. Genome-wide analysis of gene
expression profiles associated with cell cycle transitions in
growing organs of Arabidopsis. Plant Physiology 138, 734–743.
Bernards R, Schackleford GM, Gerber MR, et al. 1989.
Structure and expression of the murine retinoblastoma gene and
characterization of its encoded protein. Proceedings of the
National Academy of Sciences, USA 86, 6474–6478.
Boehmelt G, Ulrich E, Kurzbauer R, Mellitzer G, Bird A,
Zenke M. 1994. Structure and expression of the chicken retinoblastoma gene. Cell Growth and Differentiation 5, 221–230.
Boniotti MB, Gutiérrez C. 2001. A cell-cycle-regulated kinase
activity phosphorylates plant retinoblastoma protein and contains,
in Arabidopsis, a CDKA/cyclin D complex. The Plant Journal
28, 341–350.
Brehm A, Kouzarides T. 1999. Retinoblastoma protein meets
chromatin. Trends in Biochemical Sciences 24, 142–145.
Cannon SB, Sterck L, Rombauts S, et al. 2006. Legume genome
evolution viewed through the Medicago truncatula and Lotus
japonicus genomes. Proceedings of the National Academy of
Sciences, USA 103, 14959–14964.
Chen M, Presting G, Barbazuk WB, et al. 2002. An integrated
physical and genetic map of the rice genome. The Plant Cell 14,
537–545.
Chomczynski P, Sacchi N. 1987. Single-step method of RNA
isolation by acid guanidium thiocyanate–phenol–chloroform
extraction. Analytical Biochemistry 162, 156–159.
Claudio PP, Tonini T, Giordano A. 2002. The retinoblastoma
family: twins or distant cousins? Genome Biology 3, 3012.
Dahl M, Meskiene I, Bogre L, Ha DT, Swoboda I, Hubmann R,
Hirt H, Heberle-Bors E. 1995. The D-type alfalfa cyclin
gene cycMs4 complements G1 cyclin-deficient yeast and is
induced in the G1 phase of the cell cycle. The Plant Cell 7,
1847–1857.
den Boer BG, Murray JAH. 2000. Triggering the cell cycle in
plants. Trends in Cell Biology 10, 245–250.
Destree OH, Lam KT, Peterson-Maduro LJ, Eizema K,
Diller L, Gryka MA, Frebourg T, Shibuya E, Friend SH.
1992. Structure and expression of the Xenopus retinoblastoma
gene. Developmental Biology 153, 141–149.
Du W, Vidal M, Xie JE, Dyson N. 1996. RBF, a novel RB-related
gene that regulates E2F activity and interacts with cyclin E in
Drosophila. Genes and Development 10, 1206–1218.
Durfee T, Feiler HS, Gruissem W. 2000. Retinoblastoma-related
proteins in plants: homologues or orthologues of their metazoan
counterparts? Plant Molecular Biology 43, 635–642.
Dyson N. 1998. The regulation of E2F by pRB-family proteins.
Genes and Development 12, 2245–2262.
Ewen ME, Xing YG, Lawrence JB, Livingston DM. 1991.
Molecular cloning, chromosomal mapping, and expression of the
cDNA for p107, a retinoblastoma gene product-related protein.
Cell 66, 1155–1164.
Fountain MD, Murray JAH, Beck E. 1999. Isolation and
characterization of a plant retinoblastoma-related gene from a
photoautotrophic cell suspension culture of Chenopodium rubrum
L. Plant Physiology 119, 336–363.
Felsenstein J. 2002. PHYLIP (Phylogeny Inference Package)
Version 3.6a3. Distributed by the author. Seatle: Department of
Genetics, University of Washington.
Grafi G, Burnett RJ, Helentjaris T, Larkins BA, DeCaprio JA,
Sellers WR, Kaelin WG. 1996. A maize cDNA encoding
a member of the retinoblastoma protein family: involvement in
endoreduplication. Proceedings of the National Academy of
Sciences, USA 93, 8962–8967.
Granier C, Inzé D, Tardieu F. 2000. Spatial distribution of cell
division rate can be deduced from that of p34(cdc2) kinase
activity in maize leaves grown at contrasting temperatures and
soil water conditions. Plant Physiology 124, 1393–1402.
Gutiérrez C. 2000. Geminiviruses and the plant cell cycle. Plant
Molecular Biology 43, 763–772.
Gutiérrez C, Ramirez-Parra E, Castellano MM, del Pozo JC.
2002. G(1) to S transition: more than a cell cycle engine switch.
Current Opinion in Plant Biology 5, 480–486.
Ho A, Dowdy SF. 2002. Regulation of G(1) cell-cycle progression
by oncogenes and tumor suppressor genes. Current Opinion in
Genetics and Development 12, 47–52.
1674 Lendvai et al.
Horváth GV, Pettkó-Szandtner A, Nikovics K, Bilgin M,
Boulton M, Davies JW, Gutiérrez C, Dudits D. 1998. Prediction of functional regions of the maize streak virus replicationassociated proteins by protein–protein interaction analysis. Plant
Molecular Biology 38, 699–712.
Huntley R, Healy S, Freeman D, et al. 1998. The maize
retinoblastoma protein homologue ZmRb-1 is regulated during
maize leaf development and displays conserved interactions with
G1/S regulators and plant cyclin D (CycD) proteins. Plant
Molecular Biology 37, 155–169.
Huntley RP, Murray JAH. 1999. The plant cell cycle. Current
Opinion in Plant Biology 2, 440–446.
Huppi K, Siwarski D, Mock BA, Dosik J, Hamel PA. 1996.
Molecular cloning, chromosomal mapping, and expression of the
mouse p107 gene. Mammalian Genome 7, 353–355.
James P, Halladay J, Graig EA. 1996. Genomic libraries and
a host strain designed for highly efficient two-hybrid selection in
yeast. Genetics 144, 1425–1436.
Jiang Z, Zacksenhaus E, Gallie BL, Philips RA. 1997. The
retinoblastoma gene family is differentially expressed during
embryogenesis. Oncogene 14, 1789–1797.
Keller SA, Ullah Z, Buckley MS, William Henry R,
Arnosti DN. 2005. Distinct developmental expression of Drosophila retinoblastoma factors. Gene Expression Patterns 5, 411–421.
Kong LJ, Orozco BM, Roe JL, et al. 2000. A geminivirus
replication protein interacts with the retinoblastoma protein
through a novel domain to determine symptoms and tissue
specificity of infection in plants. EMBO Journal 19, 3485–3495.
Lee WH, Bookstein R, Hong F, Young LJ, Shew JY, Lee EY.
1987. Human retinoblastoma susceptibility gene: cloning, identification, and sequence. Science 235, 1394–1399.
Livak KJ, Schmittgen TD. 2001. Analysis of relative gene
expression data using real-time quantitative PCR and the 2–DDCt
method. Methods 25, 402–408.
Mayol X, Grana X, Baldi A, Sang N, Hu Q, Giordano A. 1993.
Cloning of a new member of the retinoblastoma gene family
(pRb2) which binds to the E1A transforming domain. Oncogene
8, 2561–2566.
Nakagami H, Kawamura K, Sugisaka K, Sekine M, Shinmyo A.
2002. Phosphorylation of retinoblastoma-related protein by the
cyclin D/cyclin-dependent kinase complex is activated at the
G1/S phase transition in tobacco. The Plant Cell 14, 1847–1857.
Nakagami H, Sekine M, Murakami H, Shinmyo A. 1999.
Tobacco retinoblastoma-related protein phosphorylated by a distinct cyclin-dependent kinase complex with Cdc2/cyclin D in
vitro. The Plant Journal 18, 243–252.
Nelson T, Langdale JA. 1989. Patterns of leaf development in C4
plants. The Plant Cell 1, 3–13.
Olsen AN, Ernst HA, Leggio LL, Skriver K. 2005. NAC
transcription factors: structurally distinct, functionally diverse.
Trends in Plant Science 10, 79–87.
Park JA, Ahn JW, Kim YK, Kim SJ, Kim JK, Kim WT,
Pai HS. 2005. Retinoblastoma protein regulates cell proliferation,
differentiation, and endoreduplication in plants. The Plant
Journal 42, 153–163.
Pertile P, Baldi A, De Luca A, Bagella L, Virgilio L, Pisano MM,
Giordano A. 1995. Molecular cloning, expression, and developmental characterization of the murine retinoblastoma-related gene
Rb2/p130. Cell Growth and Differentiation 6, 1659–1664.
Robbens S, Khadaroo B, Camasses A, Derelle E, Ferraz C,
Inze D, Van de Peer Y, Moreau H. 2005. Genome-wide analysis
of core cell cycle genes in the unicellular green alga Ostreococcus
tauri. Molecular Biology and Evolution 22, 589–597.
Rossi V, Locatelli S, Lanzanova C, Boniotti B, Varotto S,
Pipal A, Goralik-Schramel M, Lusser A, Gatz C,
Gutiérrez C. 2003. A maize histone deacetylase and retinoblastoma-related protein physically interact and cooperate in repressing gene transcription. Plant Molecular Biology 51, 401–413.
Rossi V, Varotto S. 2002. Insights into the G1/S transition in
plants. Planta 215, 345–356.
Roudier F, Fedorova E, Györgyey J, Fehér A, Brown S,
Kondorosi A, Kondorosi E. 2000. Cell cycle function of
a Medicago sativa A2-type cyclin interacting with a PSTAIREtype cyclin-dependent kinase and a retinoblastoma protein. The
Plant Journal 23, 73–78.
Rutledge RG, Cote C. 2003. Mathematics of quantitative kinetics
PCR and the application of standard curves. Nucleic Acids
Research 31, e93.
Sabelli PA, Dante RA, Leiva-Neto JT, Jung R, GordonKamm WJ, Larkins BA. 2005. RBR3, a member of the
retinoblastoma-related family from maize, is regulated by the
RBR1/E2F pathway. Proceedings of the National Academy of
Sciences, USA 102, 13005–13012.
Sabelli PA, Larkins BA. 2006. Grass like mammals? Redundancy
and compensatory regulation within the retinoblastoma protein
family. Cell Cycle 5, 352–355.
Savouré A, Fehér A, Kalo P, Petrovics G, Csanádi G, Szécsi J,
Kiss G, Brown S, Kondorosi A, Kondorosi E. 1995. Isolation
of a full-length mitotic cyclin cDNA clone CycIIMs from
Medicago sativa: chromosomal mapping and expression. Plant
Molecular Biology 27, 1059–1070.
Sawada Y, Nomura H, Endo Y, Umeki K, Fujita T, Ohtaki S,
Fujinaga K. 1997. Cloning and characterization of the rat p130,
a member of the retinoblastoma gene family. Biochimica et
Biophysica Acta 1361, 20–27.
Schiestl RH, Gietz D. 1989. High efficiency transformation of
intact yeast cells using single stranded nucleic acids as a carrier.
Current Genetetics 16, 339–346.
Seki M, Narusaka M, Kamiya A, et al. 2002. Functional
annotation of a full-length Arabidopsis cDNA collection. Science
296, 141–145.
Soni R, Carmichael JP, Shah ZH, Murray JAH. 1995. A family
of cyclin-D homologs from plants differentially controlled by
growth regulators and containing the conserved retinoblastoma
protein interaction motif. The Plant Cell 7, 85–103.
Stevaux O, Dimova D, Frolov MV, Taylor-Harding B, Morris E,
Dyson N. 2002. Distinct mechanisms of E2F regulation by
Drosophila RBF1 and RBF2. EMBO Journal 16, 4927–4937.
Umen JG, Goodenough UW. 2001. Control of cell division by
a retinoblastoma protein homolog in Chlamydomonas. Genes and
Development 15, 1652–1661.
Voorhoeve PM, Hijmans ME, Bernards R. 1999. Functional
interaction between a novel protein phosphatase 2A regulatory
subunit, PR59, and the retinoblastoma-related p107 protein.
Oncogene 18, 515–524.
Weinberg RA. 1995. The retinoblastoma protein and cell cycle
control. Cell 81, 323–330.
Xiao B, Spencer J, Clements A, Ali-Khan N, Mittnacht S,
Broceno C, Burghammer M, Perrakis A, Marmorstein R,
Gamblin S. 2003. Crystal structure of the retinoblastoma
suppressor protein bound to E2F and the molecular basis of its
regulation. Proceedings of the National Academy of Sciences,
USA 100, 2363–2368.
Xie Q, Sanz-Burgos AP, Hannon GJ, Gutierrez C. 1996. Plant
cells contain a novel member of the retinoblastoma family of
growth regulatory proteins. EMBO Journal 15, 4900–4908.
Xie Q, Suárez-López P, Gutiérrez C. 1995. Identification and
analysis of a retinoblastoma binding motif in the replication
protein of a plant DNA virus: requirement for efficient viral DNA
replication. EMBO Journal 14, 4073–4082.
Complexity of the plant RBR pathway 1675
Yan Y, Mumby MC. 1999. Distinct roles for PP1 and PP2A in
phosphorylation of the retinoblastoma protein. Journal of
Biological Chemistry 274, 31917–31924.
Zamora AB, Scott KJ. 1983. Callus formation and plant
regeneration from wheat leaves. Plant Science Letters 29,
183–189.
Zhang HS, Dean DC. 2001. RB-mediated chromatin structure regulation and transcriptional repression. Oncogene 20, 3134–3138.
Zimmermann
P, Hirsch-Hoffmann M, Hennig L,
Gruissem W. 2004. GENEVESTIGATOR. Arabidopsis Microarray Database and Analysis Toolbox. Plant Physiology 136,
2621–2632.