* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download Ch 17 Protein Synthesis
RNA silencing wikipedia , lookup
Community fingerprinting wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
Transcription factor wikipedia , lookup
List of types of proteins wikipedia , lookup
Promoter (genetics) wikipedia , lookup
Polyadenylation wikipedia , lookup
Peptide synthesis wikipedia , lookup
Cell-penetrating peptide wikipedia , lookup
Non-coding DNA wikipedia , lookup
Molecular evolution wikipedia , lookup
Protein structure prediction wikipedia , lookup
Amino acid synthesis wikipedia , lookup
Eukaryotic transcription wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
RNA polymerase II holoenzyme wikipedia , lookup
Silencer (genetics) wikipedia , lookup
Bottromycin wikipedia , lookup
Deoxyribozyme wikipedia , lookup
Proteolysis wikipedia , lookup
Non-coding RNA wikipedia , lookup
Point mutation wikipedia , lookup
Gene expression wikipedia , lookup
Biochemistry wikipedia , lookup
Transcriptional regulation wikipedia , lookup
Messenger RNA wikipedia , lookup
Nucleic acid analogue wikipedia , lookup
Transfer RNA wikipedia , lookup
Genetic code wikipedia , lookup
Chapter 17 DNA – mRNA – Enzyme Life Almost Chapter 17 DNA – mRNA – Protein Life Almost Chapter 17 DNA – mRNA – Polypeptide Life Almost Chapter 17 DNA – mRNA – Polypeptide (most of the time) Life Yes really! I. Eukaryotic Genome Review Eukaryotes I. Eukaryotic Genome Review Eukaryotes Multiple chromosomes Linear chromosomes Located in nucleus Made of DNA Small coding region (few exons, lots of introns) Extranuclear DNA- Mitochondria, Chloroplasts -Replicate independently -Sometimes have plasmids Picture II. General flow of information transcription translation DNA---------------→ mRNA ------------→ polypeptide DNA TRANSCRIPTION mRNA Ribosome TRANSLATION Polypeptide (a) Prokaryotic cell. In a cell lacking a nucleus, mRNA produced by transcription is immediately translated without additional processing. Nuclear envelope DNA TRANSCRIPTION Pre-mRNA RNA PROCESSING mRNA Ribosome TRANSLATION (b) Polypeptide Figure 17.3b A. Prokaryotes can begin translation during transcription - no nuclear envelope B. Eukaryotes: separate transcription (nucleus) and translation (ribosome) C. One gene/ one polypeptide 1. however all genes are not fully translated in polypeptides 2. DNA → tRNA 3. DNA → rRNA III. DNA v RNA DNA RNA III. DNA v RNA DNA RNA Sugar, phosphate, base Sugar, phosphate, base 3’ and 5’ ends 3’ and5’ ends double stranded and antiparallel A,C,T,G single stranded deoxyribose sugar ribose sugar A,U,C,G V. Transcription Nucle ar envelo pe DN A TRANSCRIPT ION Pre-mR NA RNA PROCESSING mR NA Riboso me TRANSLAT ION Polypept ide Figure 17.3b ( b ) V. Transcription A. Basics 1. occurs in the nucleus 2. DNA template is transcribed into single strand pre- RNA using comp. base pairing 3. A-U, C-G 4. requires energy Transcription In Depth B. In Depth Initiation 1. Transcription factors help RNA polymerase II bind to promoter upstream from gene 2. Promoter region contains a TATA box which indicates non-template strand Elongation 3. no primer needed 4. RNA polymerase II unwinds and assembles pre-mRNA from 5' -- 3' Termination 5. polymerase transcribes polyadenylation signal AAUAAA 6. polymerase falls off DNA after 100+ bases • Animation please work! • http://vcell.ndsu.edu/animations/transcripti on/movie.htm • http://media.pearsoncmg.com/bc/bc_camp bell_biology_6/cipl/ins/17/HTML/source/14 .html • http://www.stolaf.edu/people/giannini/flash animat/molgenetics/transcription.swf • Back up! • Animation please work! • http://vcell.ndsu.edu/animations/transcripti on/movie.htm • http://www.stolaf.edu/people/giannini/flash animat/molgenetics/transcription.swf • Back up! V. Processing pre-mRNA http://highered.mcgraw-hill.com/sites/00724 37316/student_view0/chapter15/animation s.html# V. Processing pre-mRNA A. 5' cap: G-P-P-P B. poly-A tail: 50- 250 adenines added to 3’ end C. excision of introns 1. introns are cut out using a spliceosome 2. exons are joined together, ready to leave nucleus D. Importance of Introns 1. regulatory role (not all junk) 2. allow alternative RNA splicing: multiples proteins from same exons 3. safe crossing over E. Regulating transcription with RNAi E. Regulating transcription with RNAi 1. RNAi bind to mRNA sequences 2. can increase or decrease level of transcription → protein production 3. used to silence genes, role in defense VI. tRNA VI. tRNA Structure Function VI. tRNA Structure 3 loops- but L shape Function match anticodon to mRNA codon VI. tRNA Structure 3 loops- but L shape amino acid attached to 3' Function match anticodon to mRNA codon pick up correct amino acid VI. tRNA Structure 3 loops- but L shape amino acid attached to 3' Function match anticodon to mRNA codon pick up correct amino acid anticodon on bottom loop transfer new amino acids to growing polypeptide VII. ribosomes VII. Ribosomes Structure Function VII. Ribosomes Structure Function Built from rRNA (ribozyme) Catalyze peptide bond and proteins formation between new amino acids VII. Ribosomes Structure Function Built from rRNA (ribozyme) Catalyze peptide bond and proteins formation between new amino acids Contain a small and large subunit Allow bonding of new aa from tRNA VII. Ribosomes Structure Function Built from rRNA (ribozyme) Catalyze peptide bond and proteins formation between new amino acids Contain a small and large subunit P-site: Allow bonding of new aa from tRNA holds growing polypeptide VII. Ribosomes Structure Function Built from rRNA (ribozyme) Catalyze peptide bond and proteins formation between new amino acids Contain a small and large subunit P-site: Allow bonding of new aa from tRNA holds growing polypeptide A-site: holds amino acid to be added VII. Ribosomes Structure Function Built from rRNA (ribozyme) Catalyze peptide bond and proteins formation between new amino acids Contain a small and large subunit P-site: Allow bonding of new aa from tRNA holds growing polypeptide A-site: holds amino acid to be added E-site: discharges tRNA without amino acid VIII. Translation A. Basics 1. Translation occurs at ribosomes 2. mRNA is translated into amino acid sequence (polypeptide) http://www.biostudio.com/demo_freeman_pr otein_synthesis.htm http://www.stolaf.edu/people/giannini/flashan imat/molgenetics/translati on.swf http://highered.mcgraw-hill.com/sites/00724 37316/student_view0/chapter15/animation s.html# B. Codons 1. 3 base sequence on mRNA read from 5' -- 3‘ 2. 3 bases code for one amino acid 3. Start codons = AUG Stop codons = UAA, UAG, UGA 4. Codons are redundant - 61 codons and only 20 amino acids 5. Unambiguous- one codon never codes for more than one amino acid 6. Genetic code is universal a. must have been operating very early in life b. all descendents use the same code c. cells come from cells → all organisms are related C. Initiation 1. small ribosomal subunit binds to mRNA upstream from the start codon 2. ribosome scans mRNA until it put start codon (AUG) at the P-site 3. tRNA with Met hydrogen bonds to start codon 4. large subunit attaches 5. driven by GTP hydrolysis D. Elongation 1. codon recognition- tRNA with amino acid bonds to complementary mRNA codon at A (requires 2 GTP) 2. peptide bond formation: rRNA catalyzes formation of peptide bond between amino acid at the P site and A site, polypeptide is now at the A site 3. translocation: ribosome moves polypeptide at A-site to P-site, empty P site tRNA moves to E-site, A-site is now open for new aminoacyl- tRNA (requires GTP) http://www.biostudio.com/demo_freeman_pr otein_synthesis.htm http://www.stolaf.edu/people/giannini/flashan imat/molgenetics/translati on.swf http://highered.mcgraw-hill.com/sites/00724 37316/student_view0/chapter15/animation s.html# E. Termination 1. stop codon signals a release factor to bind to A-site 2. release factor adds water to polypeptide which hydrolyses polypeptide and tRNA 3. polypeptide leaves through tunnel in large ribosomal subunit 4. ribosomal complex breaks apart IX. Modifying and transporting polypeptides A. Modifications 1. amino acids cut 2. polypeptides merge 3. addition of cofactors B. Protein destinations 1. RER→ Golgi→ lysosome or cell membrane 2. Free ribosome→ cytoplasm C. Protein function → phenotypes (Life is all about proteins) 1. Enzymatic reactions: lactose intolerance 2. Transport by proteins: cystic fibrosis (CTFR transport gene) 3. Synthesis: failure to produce myelin→ multiple sclerosis 4. Degradation: apoptosis → cell death X. Mutations A. Mutagens 1. mutagens- physical or chemical agents causing changes in base pairs a. base analogs pair incorrectly, chemical insert themselves instead of bases b. UV light, X-rays 2. Whether or not a mutation is detrimental, beneficial or neutral depends on the environmental context. Mutations are the primary source of genetic variation. Types of mutations DNA ACGGCCGGCACTGCCTACTCCTACGG TGCCGGCCGTGACGGATGAGGATGCC RNA ACGGCCGGCACUGCCUACUCCUACGG AA B. Point mutations- changes in one base pair 1. substitution- incorrect base pair is substituted a. can have no effect (wobble on 3rd base) b. missense- codes for wrong amino acid → usually nonfunctional c. nonsense- codes for stop → nonfunctional 2. insertions and deletions- addition of loss of nucleotides a. shirt reading frame of codons frameshift mutation b. all nucleotides downstream are affected c. leads to missense followed probably by nonsense