Download Stages of Translation (Biol 200 Sp2015): KEY Initiation

Stages of Translation (Biol 200 Sp2015):
KEY
Initiation
Step 1: Study the model of initiation below and answer questions 1-2.
RBS
The ribosome is made up of both protein and RNA. A small ribosomal RNA is positioned in the small
subunit that will bind to a part of the mRNA.
1. Focus on the first figure to answer the following questions about Ribosome Binding:
a. Circle the ribosome binding site (RBS) in the mRNA.
b. Which are more prevalent in the RBS: pyrimidines or purines? ____Purines__________
c. Is the RBS closer to the 5' or 3' end of the mRNA? ____5’____
d. What types of bonds do you think hold the mRNA and small ribosomal subunit
together? Why? Hydrogen bonds
2. Now focus on the second and third figures to answer the following questions about Initiation:
a. Does the first tRNA bind before or after the ribosome is complete? __Before____
b. What sequence does the first tRNA bind to? ____AUG__________
This is called the START codon and is the same for all proteins.
c. What amino acid does every protein start with? ___Methionine (MET)_________
d. Where is the START codon, relative to the RBS?_____3’ (downstream)_________
e. What does the location of the START codon tell you about the direction the ribosome is
moving? Since the START codon is downstream of the RBS, the ribosome must bind
initially to the 5’ end and then move 5’ to 3’ to reach the START codon (to the right in
the picture)
Step 2: List the key concepts and/or main points that you have learned about your stage of
translation. In your list include the following information: 1) the three steps of initiation and 2) the
direction the ribosome moves during translation
Key concepts:
Steps in initiation: 1) binding of small ribosomal subunit to the 5’ end of the mRNA, 2) scanning
of the small ribosomal subunit to find the first Start codon followed by binding of the f-met
tRNA, 3) Addition of the large ribosomal subunit to form the complete ribosome
The ribosome moves down the mRNA in a 5’ to 3’ direction
You may have additional key concepts
Step 3: Check Your Understanding with the following question:
The reading frame is defined as the division of a sequence of DNA or RNA into a particular series of
three-nucleotide codons. What establishes the reading frame during translation initiation?
(circle the correct answer)
A.
B.
C.
D.
Ribosome Binding Site (RBS)
Start Codon
5’ end of the mRNA
Distance between the Ribosome Binding Site (RBS) and the start codon
Step 4: Move on to Elongation.
2
Stages of Translation (Biol 200 W2015):
Elongation
Step 1: Study the model of Elongation below and answer questions 1-4.
879%(7"4'$("
!"#$%&'('$"
!")'('$"
-./"012#"
134'5'67"
612#"
,+"
*+"
*+"
,+"
1. On the cartoon,
(a) Label the following:
i. the amino acid glutamine,
ii. a ribosome,
iii. a mRNA,
iv. the tRNA carrying glutamine: Label the 5’ and 3’ ends of the anticodon.
v. a peptide bond
vi. the codon for glutamine: Label the 5’ and 3’ ends of the codon.
(Note that the anticodon 3’ to 5’ is in the opposite orientation to the codon which
is 5’ to 3’)
(b) Draw an arrow showing the direction the ribosome is translocating along the mRNA
during elongation. (Ribosome moves to the right in the 5’ to 3’ direction)
2. Which molecule contains codons? __mRNA_________ Which contains anticodons? __tRNA____
3. Based on what you know about DNA, what type of bonds do you think hold the codon and
anticodon together?______H-bonds__________________
4. How many nucleotides are there in a codon? ___3_______ In an anticodon? ___3______
5. Do codons overlap? ___No_______ What does this suggest about how far the ribosome moves
(translocates) at each step of elongation?__Must move 3 nucleotides at a time_____________
6. Looking at the cartoon above:
(a) What is the first peptide bond that formed in this protein? ____Met-Glu____________
(b) Which covalent bond must be broken before the next peptide bond forms?___Bond
between Glu and the tRNA carrying Glu___________________________
3
Step 2: List the key concepts and/or main points that you have learned about your stage of
translation. In your list include the following information: 1) the three steps in elongation and 2) the
relationship between codons and anticodons
Key concepts:
Steps in elongation: 1) tRNA enters A site; anticodon on tRNA interacts with codon on mRNA, 2)
Formation of peptide bond and transfer of growing peptide to tRNA in A site 3) translocation of
ribosome 3 nucleotides resulting in tRNA in A site moving to P site and the tRNA in P site moving
to E site where the tRNA is released.
The codons are on the mRNA and specify a single amino acid. The tRNA contains a
complementary anticodon sequence that can form hydrogen bonds with the codon on the mRNA.
You may have additional key concepts
Step 3: Check your understanding with the following question:
The following statement is partially correct. Write a better statement that is completely correct and
describes the process more accurately: “If a tRNA is carrying the wrong amino acid, then the ribosome will
still use the tRNA but no protein will be formed.”
If the tRNA is carrying the wrong amino-acid, then the ribosome will use the tRNA as normal but
attach the incorrect amino-acid into the new protein. Therefore a protein will be formed, but with
potential changes to its structure and/or function
Step 4: Move on to Termination
4
Stages of Translation (Biol 200 W2015):
Termination
Step 1: Study the model of Termination below and answer questions 1-4.
Model of Translation Termination. The E, P, and A sites of the ribosome are labeled.
1.Based on the model, list two things that are different between the release factor and a tRNA:
_______no amino acid attached________
__________no anticodon___
2. Based on the figures, list two things that happen after release factor binds to the ribosome:
i. ________The new protein is separated from the last tRNA_________________
ii. __ The large and small ribosomal subunits separate and fall off the mRNA___
3. What is the sequence of the codon that indicates the end of this protein? ___UAG________
(This is called a "STOP codon". This is one of 3 possible STOP codons.)
4. The release factor binds to the A-site relatively weakly compared to the correct tRNA. Why is this
weak binding a good thing for correct translation of proteins?
If the release factor bound tightly, it would terminate translation too often. This would stop the
production of all but the shortest proteins.
5
Step 2: List the key concepts and/or main points that you have learned about your stage of
translation. In your list include the following information: 1) the role of a release factor during
termination and 2) how the structure of the release factor impacts its function.
Key concepts:
The release factor’s role is to catalyze the hydrolysis of the bond between the last tRNA and the
completed protein.
The release factor does not have an anticodon or carry an amino acid, but it is the same shape as a
tRNA so it can fit into the A site.
You may have additional key concepts
Step 3: Check your understanding of termination with the following question:
1. What would happen if there was a tRNA in the cell that could base pair with a stop codon?
An amino acid would be added instead of terminating translation. The protein might continue
translating into a much larger molecule.
Step 4: Review this activity in preparation for instructor clicker questions.
6
Integration Questions
1. What is the purpose of translation?
To make proteins using mRNA as a template
2. In the chart below, fill in the function of each of the components and whether they are necessary
for the different stages of translation
Component
Function
Binds to start codon
Necessary for
initiation?
Yes
Necessary for
elongation?
No
Necessary for
termination?
No
f-Met tRNA
mRNA
Template/substrate
Yes
Yes
Yes
ribosome
Enzyme that catalyzes
translation
Binds to stop codon and
terminates translation
Binds to the codon
Yes
Yes
Yes
No
No
Yes
Yes
Yes
No
release
factor
anticodon
3. Which of the following best describes how a ribosome moves along the mRNA after binding a
start codon?
a. The ribosome moves 1 nucleotide at a time
b. The ribosome moves 2 nucleotides at a time
c. The ribosome moves 3 nucleotides at a time
4. What is the next codon that will be read by the ribosome in the schematic on the 1st page of the
Translation activity (initiation)? ___GAA______
5. What two features of a tRNA allow it to function as an “adapter” molecule between mRNA and
protein?
1. contains an anticodon that recognizes the codon
2. carries an amino acid
6. What would happen if all the tRNAs in a cell with anticodons for lysine carried glycine amino
acids instead of lysine amino acids? Circle the correct answer.
A. Translation would stop at the first lysine codon
B. Translation would still occur but there would be no lysines or glycines in the protein
C. Translation would still occur but the protein product would contain lysines in place of glycines
D. Translation would still occur but the protein product would contain glycines in place of
lysines
7
7. Imagine you replace four purines with pyrimidines in a ribosome binding site (RBS).
Which of the following statements would be true?
T F The rate of formation of peptide bonds will decrease
T F The affinity of small ribosome subunit for the ribosome binding site will decrease
T F The rate of initiation will decrease
T F The affinity of large ribosome subunit for small ribosome subunit will decrease
8. The model on the right shows translation termination with the release factor bound to the A site.
How is a release factor similar to a tRNA?
Similar overall shape to fit into the A site
How is it different?
It does not contain an anticodon and does not carry an amino acid
8
On your own questions for practice:
The reaction catalyzed by the
ribosome is shown to the right.
1. Label an arrow pointing to...
... an "Amino-acyl tRNA"
... the "Peptidyl tRNA"
... the "Empty tRNA"
amino acid
tRNA with the
nucleotide at one end
shown much larger
than the rest of the
molecule
2. The drawing to the right
shows a short protein of 8 amino
acids that is complete, but is still
in the ribosome.
a. Label the amino terminus and
the soon-to-be-carboxyl
terminus
of the protein. N-terminus at the
top, C-terminus at the bottom
of the page
b. Draw a square around a
peptide bond.
Three are shown here.
3. This is the sequence of a complete mRNA from a bacterial cell:
5' UCAAGGAGGCGUUAGCAUGAAAUUUAUGGGGCGGGUAUAGCUAGCAUUUCAAG 3'
a. Write the protein sequence that is translated from this mRNA on the line below, and label the
amino (N) and carboxyl (C) termini of the protein.
N-Met-Lys-Phe-Met-Gly-Arg-Val-C (Do NOT write "stop" in your protein. Stop is not an amino
acid!)
b. How many tRNAs will bind to the ribosome to make this protein? _____7____
c. Which of the following sequences within the mRNA most likely contains the ribosome binding
site? (Circle ONE)
5'AAGGAGGC3'
9
4. For each different mutant cell
described below, assume that ONE
specific molecule or part of a molecule
is mutated in that cell so that the
molecule’s function has changed.
Name as many molecules that could
result in the description (but remember
that for the mutant phenotype, you are
considering each mutation by itself).
Cell 1: In many different types of
proteins, there is the amino
acid Thr (threonine) where an
Ala (alanine) should be.
________________________
The tRNA with the alanine anticodon
has a threonine attached to it instead
of an alanine (alternatively, you could say that the amino-acyl tRNA synthetase that normally
“charges” the alanine tRNA is mutated so it binds threonine instead)
Cell 2: Many different types of proteins are much shorter than
in a normal cell, but have the correct sequence up to that
point. tRNA levels are normal in the cell.
release factor
________________________
Cell 3: About a third of all new proteins in a mutated cell are not doing their jobs correctly. When you
compared to proteins in a healthy cell, these proteins appear much larger overall.
Some tRNA has changed it’s anticodon to recognize one of the three STOP codons, so this is
erroneously continuing to elongate all proteins that normally use that STOP codon
10