* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Download (Chapter 8) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk
Gel electrophoresis of nucleic acids wikipedia , lookup
Mitochondrial DNA wikipedia , lookup
Minimal genome wikipedia , lookup
Polycomb Group Proteins and Cancer wikipedia , lookup
Oncogenomics wikipedia , lookup
History of RNA biology wikipedia , lookup
Human genome wikipedia , lookup
Epitranscriptome wikipedia , lookup
Non-coding RNA wikipedia , lookup
Gene expression profiling wikipedia , lookup
Expanded genetic code wikipedia , lookup
DNA polymerase wikipedia , lookup
DNA damage theory of aging wikipedia , lookup
Genomic library wikipedia , lookup
Epigenomics wikipedia , lookup
DNA vaccination wikipedia , lookup
Genome evolution wikipedia , lookup
Cancer epigenetics wikipedia , lookup
Cell-free fetal DNA wikipedia , lookup
Genetic engineering wikipedia , lookup
Molecular cloning wikipedia , lookup
Frameshift mutation wikipedia , lookup
Epigenetics of human development wikipedia , lookup
Nutriepigenomics wikipedia , lookup
Nucleic acid double helix wikipedia , lookup
DNA supercoil wikipedia , lookup
No-SCAR (Scarless Cas9 Assisted Recombineering) Genome Editing wikipedia , lookup
Extrachromosomal DNA wikipedia , lookup
Non-coding DNA wikipedia , lookup
Designer baby wikipedia , lookup
Genome (book) wikipedia , lookup
Genome editing wikipedia , lookup
Genetic code wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
Site-specific recombinase technology wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
Primary transcript wikipedia , lookup
Nucleic acid analogue wikipedia , lookup
Microevolution wikipedia , lookup
History of genetic engineering wikipedia , lookup
Therapeutic gene modulation wikipedia , lookup
Deoxyribozyme wikipedia , lookup
Point mutation wikipedia , lookup
Microbial Genetics (Chapter 8) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College Eastern Campus Primary Source for figures and content: Tortora, G.J. Microbiology An Introduction 8th, 9th, 10th ed. San Francisco: Pearson Benjamin Cummings, 2004, 2007, 2010. Amy Warenda Czura, Ph.D. 1 SCCC BIO244 Chapter 8 Lecture Slides Genetics = science of heredity study of what genes are, how they carry info, how they are replicated, passed along, and how expression of the info determines characteristics of the organism Genome = all genetic info in a cell Chromosome = organized unit of genome; bundle of DNA bacteria have 1, humans have 46 Genes = segments of DNA that code for functional products (rRNA, tRNA or protein) Genomics = field of genetics involved in sequencing and molecular characterization of genomes Many organisms sequences known: e.g. E.coli = 4 million bp (~3-4 thousand genes) Yeast= 12 million bp (~5-6 thousand genes) Human= 3 billion bp (~25-50 thousand genes) Amy Warenda Czura, Ph.D. 2 SCCC BIO244 Chapter 8 Lecture Slides DNA = macromolecule, strands of nucleotides nucleotide = nitrogenous base + deoxyribose + phosphate -deoxyribose and phosphate form linear strand, “backbone” -nitrogenous bases hang off side -two strands held together by H-bonding between bases, forms a double helix, two strands wound around each other -base pairing: A-T, G-C -bases on one strand determine bases on the other: the strands are complementary -sequence contains genetic info Amy Warenda Czura, Ph.D. 3 SCCC BIO244 Chapter 8 Lecture Slides Features of biological info storage: 1. linear sequence of bases provides actual genetic info: only four bases but in chain of X length there are 4X possibilities of different orders e.g. chain 2 bases long, using 4 possible bases, 42 = 16 possible configurations: AA TA CA GA AT TT CT GT AC TC CC GC AG TG CG GG 2. complementary structure of DNA allows precise duplication: one strand determines sequence of other: A-T, G-C Amy Warenda Czura, Ph.D. 4 SCCC BIO244 Chapter 8 Lecture Slides Genotype = DNA, genetic makeup all the genes that can encode characteristics of an organism, potential properties Phenotype = protein the observed outcome of gene expression the appearance or metabolic capabilities of an organism Gene expression = turning the info from the gene in DNA into the molecule it encodes, usually a protein Not all genes are expressed: if not expressed the gene cannot contribute to the phenotype DNA and Chromosomes -bacteria: usually one chromosome (yeast -7 humans -46) -bacterial chromosome is circular DNA with associated proteins, attached to plasma membrane (eukaryotes = linear chromosomes, in nucleus) Amy Warenda Czura, Ph.D. 5 SCCC BIO244 Chapter 8 Lecture Slides -the DNA is ~1000x longer than cell but chromosome structure is organized to occupy only 10% of cell volume DNA Replication -must replicate DNA to pass genetic info to progeny cells -process converts one parental molecule into two identical daughter molecules Amy Warenda Czura, Ph.D. 6 SCCC BIO244 Chapter 8 Lecture Slides -process is semi-conservative: each strand of parental molecule is template for new strand, and new molecules contain half parental and half new DNA complementary base paired Amy Warenda Czura, Ph.D. 7 SCCC BIO244 Chapter 8 Lecture Slides -DNA is a directional molecule -two strands in double helix are anti-parallel: run in opposite directions -directionality dictated by the sugar-phosphate bonds of the backbone: P on 5’carbon of nucleotide gets bound to OH on 3’ carbon of next nucleotide -DNA polymerase (enzyme for DNA synthesis) can add nucleotides only to the 3’ end of a growing molecule Amy Warenda Czura, Ph.D. 8 SCCC BIO244 Chapter 8 Lecture Slides -new strands synthesized in opposite directions -energy for bond making comes from free nucleotides in tri-phosphate forms: ATP, TTP, GTP, CTP -two phosphates are removed and energy is used to create the sugar-phosphate (OH to P) bond between nucleotides DNA Replication Events (on handout) Amy Warenda Czura, Ph.D. 9 SCCC BIO244 Chapter 8 Lecture Slides DNA Replication 1. Enzymes, gyrase and helicase, unwind the parental double helix at a site called the origin of replication. 2. Proteins stabilize the unwound parental DNA creating the replication fork. 3. Beginning with an RNA primer complementarily base paired to the single stranded parental DNA, the leading strand is synthesized continuously by the enzyme DNA polymerase in the direction of the replication fork. New tri-phosphate nucleotides from the cytoplasm/nucleoplasm are complementarily base paired with the parental strand and chemically bonded to the 3’end of the RNA primer and subsequently to each other at the 3’ends (via removal of two phosphates) to create a new DNA strand. 4. The lagging strand is synthesized discontinuously: At the replication fork an RNA primer complementarily pairs with the single stranded parental DNA. Nucleotides are complementarily base paired to the single stranded DNA molecule and bonded to the 3’ end of the RNA primer and growing chain by DNA polymerase, working away from the replication fork for ~1000bases. The resulting segment is called an Okazaki fragment. 5. As the replication fork moves forward, the leading strand continues to have nucleotides added to the 3’ end. The lagging strand begins another Okazaki fragment. DNA polymerase digests the RNA primers on completed Okazaki fragments on the lagging strand and replaces them with DNA nucleotides. 6. As each Okazaki fragment ends at the beginning of the previous one, the enzyme DNA ligase bonds the neighboring fragments into a single continuous molecule. 7. Replication continues down the full length of the chromosome until both parental strands are completely separated and each is base paired to a newly synthesized strand. Amy Warenda Czura, Ph.D. 10 SCCC BIO244 Chapter 8 Lecture Slides Bacterial chromosomes can replicate bidirectionally: one origin of replication with two replication forks moving in opposite directions Amy Warenda Czura, Ph.D. 11 SCCC BIO244 Chapter 8 Lecture Slides -origin of replication is associated with the plasma membrane to insure separation of duplicated chromosomes to each daughter cell during binary fission DNA replication accurate: DNA polymerase has proofreading ability to insure proper base pairing before backbone is chemically bonded Error rate = ~1 in 109 bases error = mutation Gene Expression: RNA and protein synthesis -DNA replication only occurs in cells that are dividing -gene expression occurs in all cells all the time: cells are constructed of protein and require enzymes to function DNA --------------> RNA --------------> Protein transcription translation Amy Warenda Czura, Ph.D. 12 SCCC BIO244 Chapter 8 Lecture Slides Transcription = synthesis of complementary strand of RNA from DNA template Translation = synthesis of protein from info on mRNA template Gene Structure (on handout) Promoter Open Reading Frame (ORF) (codons for amino acids) Terminator Stop codon Start codon The Promoter and Terminator are directions for RNA polymerase to indicate the location of the gene to be transcribed The start and stop codons are directions for the ribosome to indicate where the amino acid information for translation begins and ends The ORF is the “coding” region of the gene: it begins at the start codon and contains in order all the codons for all the amino acids in the resulting protein. (3 bases of DNA = 1 codon, each codon indicates one of the 20 amino acids) The ORF ends at the stop codon. Amy Warenda Czura, Ph.D. 13 SCCC BIO244 Chapter 8 Lecture Slides Transcription making RNA from DNA 3 types of RNA: 1. Ribosomal RNA (rRNA) - integral part of ribosomes, which carry out protein synthesis 2. Transfer RNA (tRNA) - bring amino acids to ribosome for use in protein synthesis 3. Messenger RNA (mRNA) - carries coded info for synthesis of specific proteins from DNA gene to ribosome for use RNA is synthesized as complementary copy of a DNA gene except that T is replaced by U The complement is produced from the template or sense strand of the DNA gene Coding/Antisense strand of the DNA: ATGGTATTCTCCTATCGTTAA Template/Sense of the DNA gene: TACCATAAGAGGATAGCAATT RNA: AUGGUAUUCUCCUAUCGUUAA Amy Warenda Czura, Ph.D. 14 SCCC BIO244 Chapter 8 Lecture Slides Transcription Events (on handout) Amy Warenda Czura, Ph.D. 15 SCCC BIO244 Chapter 8 Lecture Slides Translation -protein synthesis at the ribosome DNA: 4 different bases in a particular order make up the gene sequence RNA: 4 bases complementary to the DNA gene make up the RNA sequence Nucleotide bases are like letters in the alphabet: used in groups of three to make “words”; each word indicates a particular amino acid 3 nucleotides = 1 codon Each codon = one amino acid of the 20 possible Translation involves “reading” the codons on the mRNA to build the polypeptide using the correct amino acids in the order specified by the gene The Genetic Code -all organisms use the same codons to specify the particular amino acids Amy Warenda Czura, Ph.D. 16 SCCC BIO244 Chapter 8 Lecture Slides 64 possible codons (43) but only 20 amino acids: some are redundant 61 codons code for amino acids = sense codons 3 nonsense codons serve as the STOP signal to terminate protein synthesis For each sense codon there is a tRNA with a complementary antisense codon: this tRNA carries the amino acid specified by the codon There are no tRNA molecules with anticodons to the 3 nonsense codons (stop codons): UAA, UAG, UGA, and thus no amino acids The start codon is AUG and codes for the amino acid methionine The start codon establishes the reading frame of the mRNA: all other codons (each three nucleotides) can be read once the start has been identified Amy Warenda Czura, Ph.D. 17 SCCC BIO244 Chapter 8 Lecture Slides on han dou t Use the genetic code chart to decode the amino acid sequence of any mRNA: AUG /GUA /UUC /UCC /UAU /CGU /UAA AUG /GUA /UUC /UCC /UAU /CGU /UAA Met - Val -Phe -Ser -Tyr -Arg -STOP Amy Warenda Czura, Ph.D. 18 SCCC BIO244 Chapter 8 Lecture Slides Translation Events (on handout) Translation begins at the AUG codon Amy Warenda Czura, Ph.D. 19 SCCC BIO244 Chapter 8 Lecture Slides Amy Warenda Czura, Ph.D. 20 SCCC BIO244 Chapter 8 Lecture Slides Amy Warenda Czura, Ph.D. 21 SCCC BIO244 Chapter 8 Lecture Slides Amy Warenda Czura, Ph.D. 22 SCCC BIO244 Chapter 8 Lecture Slides Translation ends at the stop codon because: -no tRNA with a complementary anticodon exists to pair with a stop codon -no amino acid arrives to be peptide bonded to the chain Amy Warenda Czura, Ph.D. 23 SCCC BIO244 Chapter 8 Lecture Slides Once the ribosome begins moving along the mRNA molecule the start codon is exposed and another ribosome can assemble and begin translation In prokaryotes there is no nuclear separation so translation can begin before transcription is complete Amy Warenda Czura, Ph.D. 24 SCCC BIO244 Chapter 8 Lecture Slides In eukaryotes, transcription occurs in the nucleus: mRNA must exit to the cytoplasm before translation can begin Also eukaryotic RNA must be processed before a functional mRNA is generated Eukaryotic genes contain introns and exons exons = coding portion (codons) introns = “junk” RNA generated by complementary base pairing to the template DNA contains both introns and exons. Amy Warenda Czura, Ph.D. 25 SCCC BIO244 Chapter 8 Lecture Slides Small nuclear ribonucleoproteins (snRNPs) cut out the introns and splice together the exons to form mRNA that can be used for translation Exons can provide variability: many mRNA configurations can be formed from a single gene with multiple exons e.g. use all or only some of the exons: 3 exons = 7+ different mRNAs (and thus proteins) 1-2-3, 1-2, 1-3, 2-3, 1, 2, 3 Amy Warenda Czura, Ph.D. 26 SCCC BIO244 Chapter 8 Lecture Slides Regulation of Bacterial Gene Expression -protein synthesis metabolically expensive: cells only make what is needed -60-80% of genes constitutively expressed: “housekeeping genes” -genes not involved in normal or continuous processes have expression regulated -feedback inhibition regulates enzymes that have already been synthesized -genetic control mechanism control the synthesis of new enzymes Genetic Control Mechanisms: -regulate transcription of mRNA, thus control enzyme synthesis Two Mechanisms: 1. Induction 2. Repression Amy Warenda Czura, Ph.D. 27 SCCC BIO244 Chapter 8 Lecture Slides 1. Induction = mechanism that turns on the transcription of a gene and thus translation of its enzyme product -tends to control catabolic pathway enzymes -gene expression induced by substrate for pathway -default position of gene expression is ‘off’ Mode of Action: -Gene expression is off because active repressor protein blocks RNA polymerase -Inducer (substrate) binds to repressor thus inactivating it -RNA polymerase now free to transcribe gene (gene expression on) -mRNA synthesized -protein synthesized Inducible gene system → inducible enzyme Amy Warenda Czura, Ph.D. 28 SCCC BIO244 Chapter 8 Lecture Slides 2. Repression = mechanism that inhibits gene expression thus decreasing synthesis of corresponding enzyme -tends to control anabolic pathway enzymes -gene expression repressed by final product produced in pathway -default position of gene expression is ‘on’ Mode of Action: -Gene expression is on -Repressor (regulatory protein) is activated by corepressor (product) -repressor + corepressor block RNA polymerase -no mRNA synthesis (gene expression off) -no protein synthesis Amy Warenda Czura, Ph.D. 29 SCCC BIO244 Chapter 8 Lecture Slides All genes involved in one pathway are often organized together on the chromosome under control of one promoter in a unit called an operon Terminator Operon consists of: 1. Promoter: region of DNA where RNA polymerase initiates transcription 2. Operator: region of DNA that serves as stop/go signal for transcription 3. Genes: all the ORFs for all the enzymes in the pathway linked end to end; each has its own start and stop codon 4. Terminator: region of DNA where RNA polymerase ends transcription Amy Warenda Czura, Ph.D. 30 SCCC BIO244 Chapter 8 Lecture Slides An operon has only one promoter and one operator that control all the genes at once: all are expressed or none are. Each gene has its own start & stop codon: all will be transcribed on one mRNA but during translation each ORF will form its own separate protein. Terminator Transcription Translation D E B C Amy Warenda Czura, Ph.D. 31 A SCCC BIO244 Chapter 8 Lecture Slides Examples of genetic control of gene expression: 1. Lac Operon (on handout) O Amy Warenda Czura, Ph.D. 32 SCCC BIO244 Chapter 8 Lecture Slides 2. Tryptophan Synthesis Operon (on handout) Amy Warenda Czura, Ph.D. 33 SCCC BIO244 Chapter 8 Lecture Slides Genetic Mutations Mutation = change in base sequence of DNA Silent mutation = no change in the activity of the gene product -no change in amino acid (often third base in codon) e.g. G-C-anything = alanine -change in amino acid did not affect function of the protein Some mutations harmful: decreased activity, loss of activity Some mutations beneficial: new or enhanced activity (this drives evolution) Amy Warenda Czura, Ph.D. 34 SCCC BIO244 Chapter 8 Lecture Slides Types of mutations: 1. Base substitution / point mutation single base at one point in DNA replaced by another base A. Silent point mutation: does not change the amino acid B. Missense point mutation: causes insertion of the wrong amino acid Amy Warenda Czura, Ph.D. 35 SCCC BIO244 Chapter 8 Lecture Slides e.g. Sickle cell anemia: A → T, GAG → GTG in hemoglobin glutamic acid (+ charge) → valine (neutral) folded hemoglobin globular → fibrous RBCs round → elongated (block capillaries, don’t carry O2 well C. Nonsense point mutation: creates a stop codon in the middle of a gene - protein will be incomplete template Amy Warenda Czura, Ph.D. 36 SCCC BIO244 Chapter 8 Lecture Slides 2. Frameshift mutation one or a few nucleotides are deleted or inserted - this can alter the translational reading frame e.g. AUG GCU ACC GUC... Met - Ala - Thr - Val insert A at 4th position: AUG AGC UAC CGU C… Met - Ser - Tyr - Argtemplate Frameshift mutations almost always cause long stretch of altered amino acids resulting in inactive protein. Nonsense mutations (stop codons) can also be created Amy Warenda Czura, Ph.D. 37 SCCC BIO244 Chapter 8 Lecture Slides Spontaneous mutations: occur in absence of any mutation causing agent, represent the error rate of DNA polymerase (1 in 109) Mutagen = agent in environment that brings about DNA mutation. Usually chemically or physically interact with DNA to cause change. Once mistake is fixed into the DNA the change is permanent. 1. Chemical mutagens (examples) A. Nitrous acid: converts A so it pairs with C instead of T Amy Warenda Czura, Ph.D. 38 SCCC BIO244 Chapter 8 Lecture Slides B. Nucleoside analogs: have chemical structure similar to a base but do not base pair correctly e.g. 5-bromouracil incorporated in place of T but base pairs with G not A C. Benzopyrene (cigarette smoke): causes frameshift mutations: binds between bases and offsets the double helix strands, repair mechanisms add a base to the other strand to re-set alignment Amy Warenda Czura, Ph.D. 39 SCCC BIO244 Chapter 8 Lecture Slides 2. Radiation A. x-rays and γ-rays: create ions and free radicals that break molecular bonds B. UV: causes crosslinking of T bases (Thymine dimer) which can prevent unwinding for replication or transcription Cells have light repair enzymes called photolyases which cut out damaged Ts and replace them Amy Warenda Czura, Ph.D. 40 SCCC BIO244 Chapter 8 Lecture Slides Nucleotide excision repair = enzymes that function to cut out and replace DNA damage Amy Warenda Czura, Ph.D. 41 SCCC BIO244 Chapter 8 Lecture Slides 1. damaged parts are removed leaving gap in strand 2. gap is filled by complementary base pairing from other strand -often repair restores correct sequence -sometimes errors are made during repair: once nucleotide excision repair mechanisms seal the DNA, mutation is permanent Damage on one strand Damage on both strands ATGCTAGGCTATTATCG TACGATCCGATAATAGC ATGCTAGGCTATTATCG TACGATCCGATAATAGC ATGCT TACGAT GCTATTATCG GATAATAGC ATGCTA?GCTATTATCG TACGAT?CGATAATAGC Amy Warenda Czura, Ph.D. 42 SCCC BIO244 Chapter 8 Lecture Slides Mutation rate = probability that gene will mutate when cell divides Spontaneous mutation rate ~10-9 (1 in a billion) Average gene ~103 bp long, so approximately 1 in 106 genes mutated each replication Mutations are random If harmful, organism dies If beneficial, organism thrives and passes mutation to offspring (drives adaptation and evolution) Mutagens change rate 10-1000 fold: up to 1:1000 genes mutated each replication Amy Warenda Czura, Ph.D. 43 SCCC BIO244 Chapter 8 Lecture Slides Genetic Transfer and Recombination genetic recombination = exchange of genes between two DNA molecules to form new combinations of genes on chromosome -involves crossing over Amy Warenda Czura, Ph.D. 44 SCCC BIO244 Chapter 8 Lecture Slides Genetic recombination contributes to population diversity: recombinations more likely than mutations to provide beneficial change since it tends not to destroy gene function Eukaryotes: recombination during meiosis for sexual reproduction -creates diversity in offspring but parent remains unchanged -vertical gene transfer = genes passed from organism to offspring Prokaryotes: recombination via gene transfer between cells or within cell by transformation, conjugation, or transduction -original cell is altered -horizontal gene transfer = genes passed to neighboring microbes of same generation Amy Warenda Czura, Ph.D. 45 SCCC BIO244 Chapter 8 Lecture Slides -transfer involves donor cell that gives portion of DNA to recipient cell -when donor DNA incorporated into recipient, recipient now called recombinant cell -if recombinant cell acquired new function/characteristic as result of new DNA, cell has been transformed Generation of recombinant cells is very low frequency event (less than 1%): very few cells in population are capable of exchanging and incorporating DNA Three methods of prokaryotic gene transfer: 1. Bacterial Transformation -genes transferred as naked DNA -can occur between unrelated genus/species Amy Warenda Czura, Ph.D. 46 SCCC BIO244 Chapter 8 Lecture Slides -discovered by F. Griffith 1928 who studied Streptococcus pneumoniae -virulent strain had capsule -non-virulent stain did not -in mouse, dead virulent strain could pass “virulence factor” to live nonvirulent strain Amy Warenda Czura, Ph.D. 47 SCCC BIO244 Chapter 8 Lecture Slides -competent cells can pick up DNA from dead cells and incorporate it into genome by recombination (e.g. antibiotic resistance) -transformed cell than passes genetic recombination to progeny competent = permeable to DNA: alterations in cell wall that allow large molecule like DNA to get through (in lab we use chemical agents to poke holes) -transformation works best when donor and recipient are related but they do not have to be Amy Warenda Czura, Ph.D. 48 SCCC BIO244 Chapter 8 Lecture Slides 2. Conjugation -genes transferred between two live cells via sex pilus (Gram -) or surface adhesion molecules (Gram +) -transfer mediated by a plasmid: small circle of DNA separate from genome that is self replicating but contains no essential genes -plasmid has genes for its own transfer -Gram negative plasmids have genes for pilus -Gram positive plasmids have genes for surface adhesion molecules Conjugation requires cell to cell contact between two cells of opposite mating type, usually the same species, must be same genus Amy Warenda Czura, Ph.D. 49 SCCC BIO244 Chapter 8 Lecture Slides During conjugation plasmid is replicated and single stranded copy is transferred to recipient. Recipient synthesizes complementary strand to complete plasmid -plasmid can remain as separate circle or -plasmid can be integrated into host cell genome resulting in permanent chromosomal changes Amy Warenda Czura, Ph.D. 50 SCCC BIO244 Chapter 8 Lecture Slides 3. Transduction -DNA from a donor is carried by a virus to a recipient cell Bacteriophage / Phage = virus that infects bacterial cells -each phage is species specific (donor and recipient are the same species) Transduction mechanism: 1. Phage attaches to donor cell and injects phage DNA 2. Phage DNA directs donor cell to synthesize phage proteins and DNA, phage enzymes digest the bacterial chromosome Amy Warenda Czura, Ph.D. 51 SCCC BIO244 Chapter 8 Lecture Slides 3. New phages are assembled: phage DNA is packaged into capsids Occasionally bacterial DNA is packaged by mistake 4. Capsid containing bacterial DNA “infects” new host recipient cell by injecting the DNA 5. Donor DNA does not direct viral replication (not viral DNA): instead integrates into recipient genome Amy Warenda Czura, Ph.D. 52 SCCC BIO244 Chapter 8 Lecture Slides DNA entities used for genetic change: (in both prokaryotes and eukaryotes) 1. Plasmids = self-replicating circle of DNA containing “extra” genes A. conjugative plasmids: used in bacterial conjugation, at minimum contain genes for pili or adhesion molecules B. dissimilation plasmids: carry genes that code for enzymes to trigger catabolism of unusual carbs or hydrocarbons C. pathogenicity plasmids: carry genes that code for virulence traits → capsules, toxins, adhesion molecules, bacteriocins D. resistance factor plasmids: carry genes for resistance to antibiotic and toxins -plasmids can be transferred between species: -allows spread of antibiotic resistance between different pathogens -wide use of antibiotics has put selective pressure on microbes to “develop” and “share” resistance genes Amy Warenda Czura, Ph.D. 53 SCCC BIO244 Chapter 8 Lecture Slides 2. Transposons = small segments of DNA that can move independently from one region of DNA to another -discovered 1950s by McClintock: mosaic pattern in indian corn (Nobel Prize 1983) -transposons pop out and randomly insert at rate of 10-5 to 10-7 per generation -integration is random: can disrupt genes -at minimum transposons carry genetic info to carry out own transposition, may also carry other genes Simplest transposon = insertion sequence -gene for transposase (enzyme that cuts DNA at recognition sites and religates it elsewhere in genome) -two recognition sites called inverted repeats, mark ends of transposon, recognized by transposase Amy Warenda Czura, Ph.D. 54 SCCC BIO244 Chapter 8 Lecture Slides -complex transposons have inverted repeats outside other genes -genes will get carried with transposon when it moves -transposons can be carried between cells on plasmids or by viruses, even between species -depending on where it inserts and what genes it carries it can mediate good or bad genetic changes Amy Warenda Czura, Ph.D. 55 SCCC BIO244 Chapter 8 Lecture Slides