* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download DNA, RNA, Mutation Powerpoint
Non-coding RNA wikipedia , lookup
Eukaryotic transcription wikipedia , lookup
Holliday junction wikipedia , lookup
Promoter (genetics) wikipedia , lookup
DNA sequencing wikipedia , lookup
Comparative genomic hybridization wikipedia , lookup
Messenger RNA wikipedia , lookup
Expanded genetic code wikipedia , lookup
Transcriptional regulation wikipedia , lookup
Agarose gel electrophoresis wikipedia , lookup
Epitranscriptome wikipedia , lookup
Silencer (genetics) wikipedia , lookup
Maurice Wilkins wikipedia , lookup
Gene expression wikipedia , lookup
Biochemistry wikipedia , lookup
Genetic code wikipedia , lookup
Community fingerprinting wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
Molecular evolution wikipedia , lookup
DNA vaccination wikipedia , lookup
Bisulfite sequencing wikipedia , lookup
Transformation (genetics) wikipedia , lookup
Gel electrophoresis of nucleic acids wikipedia , lookup
Molecular cloning wikipedia , lookup
Non-coding DNA wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
DNA supercoil wikipedia , lookup
DNA, RNA, Mutations Objective 2: 6a,b,c Biology: DNA, RNA, Mutation The student knows the structures and functions of nucleic acids in the mechanisms of genetics. The student is expected to: • (A) describe components of deoxyribonucleic acid (DNA), and illustrate how information for specifying the traits of an organism is carried in the DNA; • (B) explain replication, transcription, and translation using models of DNA and ribonucleic acid (RNA); • (C) identify and illustrate how changes in DNA cause mutations and evaluate the significance of these changes P D C D T D C G D P P D P G D P D T D P C G D D Making a DNA copy of DNA is replication. Cells need to copyP their DNA for mitosis (growth, repair, and maintenance). Daughter cells are genetically P identical. DNA is also copied for meiosis (reproduction). P Daughter cells are genetically different and have ½ the # of chromosomes. P Remember THIS? DNA is made of building blocks called nucleotides. They consist of a deoxyribose sugar, a phosphate group and a nitrogen base. The bases are adenine, thymine, guanine, and cytosine. Phosphate group Deoxyribose Nitrogen Base Phosphate group RNA is made of building blocks called nucleotides. They consist of a ribose sugar (instead of a deoxyribose sugar), a phosphate group and a nitrogen base. The bases are adenine, uracil, guanine, and cytosine. ribose Nitrogen Base DNA Sugar: Deoxyribose Has the base thymine RNA Both have adenine, guanine, and cytosine as bases Both have a sugar phosphate backbone. Sugar: ribose Has the base uracil There are three types of RNA: mRNA-messenger (transcribes DNA) tRNA-transfer (translates mRNA) rRNA-ribosomal (used as a machine for translation) REPLICATION : DNA copies DNA A T G C http://www.johnkyrk.com/DNAreplication.html http://nobelprize.org/chemistry/educational/dna/b/replication/dna_c ompounds.html TRANSCRIPTION: mRNA copies DNA A U G C T A http://www.johnkyrk.com/DNAtranscription.html TRANSLATION: mRNA is decoded and a protein is made from amino acids. A U G C http://www.johnkyrk.com/DNAtranslation.html MUTATION: Any change in the DNA sequence. If it is a point mutation (one letter is changed), it can change the amino acid sequence by changing the code. ATC Deletion Point mutation ATG Translation Transcription DNA In nucleus Let’s try it: mRNA On ribosome Protein ATGTGGCAG 1. Write this DNA base pair sequence on you paper. 2. Write the complementary strand of DNA that would bond to them. 3. Translate the strand into mRNA. 4. List the amino acids that these codons stand for. Use the amino acid chart on the next slide. ATGTGGCAG- T A C A C C G T C Complementary strand that would form in Replication. TACACCGTCDNA Transcription A U G U G G C A G mRNA Methionine Peptide Bonds Tryptophan Glutamine Translation Amino Acids ATGCCATTCAATTAACCCTCC 1. Write this DNA base pair sequence on you paper. 2. Write the complementary strand of DNA that would bond to them. 3. Translate the strand into mRNA. 4. List the amino acids that these codons stand for. DNA ATG CCA TTC AAT TAA CCC TCC Original Strand DNA TAC GGT AAG TTA ATT GGG AGG Replicated Strand mRNA AUG CCA UUC AAU UAA CCC TCC Amino Acids Met Pro Phen Asp Stop DNA Simulation http://www.johnkyrk.com/DNAanatomy.html Interactive DNA Workshop http://www.pbs.org/wgbh/aso/tryit/dna/inde x.html