* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download mRNA
Maurice Wilkins wikipedia , lookup
Polyadenylation wikipedia , lookup
Gel electrophoresis wikipedia , lookup
List of types of proteins wikipedia , lookup
RNA polymerase II holoenzyme wikipedia , lookup
Promoter (genetics) wikipedia , lookup
Eukaryotic transcription wikipedia , lookup
Agarose gel electrophoresis wikipedia , lookup
RNA silencing wikipedia , lookup
Molecular cloning wikipedia , lookup
Messenger RNA wikipedia , lookup
Genetic code wikipedia , lookup
Gel electrophoresis of nucleic acids wikipedia , lookup
DNA supercoil wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
Transcriptional regulation wikipedia , lookup
Point mutation wikipedia , lookup
Real-time polymerase chain reaction wikipedia , lookup
Molecular evolution wikipedia , lookup
Community fingerprinting wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
Non-coding DNA wikipedia , lookup
Non-coding RNA wikipedia , lookup
Silencer (genetics) wikipedia , lookup
Biosynthesis wikipedia , lookup
Epitranscriptome wikipedia , lookup
Nucleic acid analogue wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
Molecular Biology I Some basic concepts Aspects to Cover DNA: structure, replication RNA: transcription and processing Protein: translation Gene Expression: levels of transcription and translation Common Techniques: DNA quantitation Gel electrophoresis Southern/ Northern blot Gene cloning Polymerase chain reaction (PCR) Quantitative Real-time PCR DNA - Molecular Structure Deoxyribonucleic acid (DNA) is the genetic code that exists within every cell. Consists of two associated strands that wind together in a helical fashion. It is often described as a double helix. DNA - Molecular Structure A single nucleotide subunit consists of a Each strand is a deoxyribose linear polymer in which sugar the monomers (deoxynucleotides), are joined to a phosphate linked together by means of group. Attached to the phosphodiester bonds. other side of the sugar molecule is one of four nitrogen bases. Nitrogen Base Pairing Purines Pyrimidines DNA Double Helix 5`end 3`end 3`end 5`end DNA – The Genetic Code DNA is essential for all living organisms. The genetic code (genotype) determines how an organism looks and functions (phenotype) The more complex the organism the larger the genome Genotype wild type Phenotype normal Genotype db/db Phenotype obese “Central Dogma” Central dogma describes information flow from DNA→RNA→protein Protein considered the functional unit within the cell DNA Replication Structure of Genomic DNA Introns Promoter 5` 1 Exon 2 3 4 5 3` Gene Promoter: Gene: Introns: Exons: coding regulatory intervening sequences and sequences regulatory within the elements that, gene that together do that that not encode combine encode with transcription the the toprotein result proteinfactors, structure instructure a protein Transcription: process tosequences produce RNA from the gene determine the amount of gene expression RNA – From gene to protein There is more than one type of ribonucleic acid... Messenger RNA (mRNA): carries the genetic information out of the nucleus for protein synthesis. Transfer RNA (tRNA): decodes the information from mRNA. Ribosomal RNA (rRNA): constitutes 50% of a ribosome, which is a molecular assembly involved in protein synthesis. Catalytic/ functional RNAs: involved in reactions in the cell. mRNA – The Cellular Messenger RNA is similar to single stranded DNA sense strand Sugar is ribose rather than deoxyribose Uracil (U) replaces thymidine (T) Carries the ‘message’ to protein construction centers - ribosomes DNA sense strand 5` ATGCGTTAGACTTGACACTGACTAC 3` 3` TACGCAATCTGAACTGTGACTGATG 3` antisense strand RNA synthesis mRNA 5` AUGCGUUAGACUUGACACUGACUAC 3` RNA has same sequence as DNA sense strand RNA is complementary to DNA antisense strand RNA DNA mRNA Processing Pre-mRNA is transcribed from DNA in nucleus by RNA polymerase Splicing removes introns from premRNA to create mRNA mRNA is transported from the nucleus to the rough endoplasmic reticulum (rER) Protein is translated from the RNA at the cytoplasm at the ribosome Protein Translation Amino acids polymerise in the order by tRNA the Occurs at ribosomes using mRNA asdetermined template and sequence of mRNA for assembly of protein building blocks – amino acids Polymerisation ofinamino acids occurs until a stop codon Ribosome shuffles along mRNA to next codon mRNA arranged codons – 3 bases is read tRNA contains specific amino acids for particular anticodons Decoding the genetic code 20 common amino acids, 1 start codon (Met - AUG), 3 stop codons (UAA, UAG, UGA) Each amino acid is encoded by one or more codons – degenerate code RNA to protein: one possible sequence Protein to RNA: many possible sequences “Gene Expression” Expression refers to both RNA and protein Gene expression is regulated at both the transcriptional and translational levels – RNA and protein expression don’t always correlate A single gene does not always produce a single protein Leptin Background Hypothalamus Ob-R -ve NPY Leptin (Ob) -ve -ve Adipocytes Alternate splicing of Ob-R Ob-RL and Ob-RS are identical in mRNA up until exon 18 Ob-RL uses exon 18a & 18b and Ob-RS uses exon 18 a Different stop codon result in different proteins Ob-RS Ob-RL Leptin Receptor – Ob-R G T Extracellular Transmembrane Intracellular Ob-RS Ob-RL Summary Small Translation changes decodes at theat the DNA information level produce from the drastic gene/mRNA DNA replicates itself every cellcan division, placing a copy of changes into ainprotein at thecell – protein theinfunctional level endpoint of gene expression itself every every organism Transcription and translation are – produces a copy of independently the DNA calledregulated RNA mRNA and protein levels are not necessarily correlated DNA/RNA Quantitation DNA/RNA can be extracted from virtually any tissue using special chemicals and purification procedures Once extracted, DNA/RNA can be dissolved in water and used for a variety of different techniques – PCR etc Absorbance Spectrophotometer can analyse the spectral properties of the nucleic acid A260/A280 = 1.8 1.60 A260 = 1.0 50 mg/ml 260 280 Similarly for RNA 0 200 350 Wavelength (nm) A260/A280 = 2.0 A260 = 1.0 40 mg/ml Gel Electrophoresis DNA can originate from a variety of sources: genomic DNA - from organisms plasmid DNA - circular, cloned fragments amplified DNA - specific fragments from PCR Knowing the size of the DNA is beneficial in identifying the fragments – distance migrated is inversely proportional to the size of the molecule DNA size is usually measured in numbers of base pairs: bp (1 – 1000) kb (thousands of bp) Mb (millions of bp) Gel Electrophoresis DNA size moves approximated according tobysize electrophoresis – small through more Due phosphate DNA has fragments negative charge Loadto DNA onto gelbackbone agarose faster electric than andlarge comparison fragments with fragments of known size Apply current to gel (100 V) Negatively charged DNA migrates to positive electrode - 1 kb 500 bp 400 bp 300 bp 200 bp ~400 bp ~250 bp 100 bp + Gel Electrophoresis Standard methodology resolves relatively small DNA molecules (0.1-50kb) % agarose determines range of DNA sizes resolved 0.3% w/v resolves DNA of 5-50 kb 2.0% w/v resolves DNA of 0.1-2 kb Ethidium bromide used to stain DNA – binds and fluoresces under UV illumination