Download Polycomb Group silencers collaborate with Notch pathway to cause

Ferres-Marco et al
1
Polycomb Group silencers collaborate with Notch to cause malignant tumours by
epigenetic Rb silencing
Ferres-Marco D.1,*, Gutierrez-Garcia I.1,*, Vallejo D.M.1,*, Bolivar J.2, Gutierrez-Aviño F.J.1 & Dominguez M.1,3
Supplementary Information
eyeful and Delta induced tumours depend on the endogenous Notch pathway
In order to determine whether the formation of eye tumours was indeed dependent on the endogenous
Notch signal transduction pathway1, we used the triple mutant strain (ey-Gal4>eyeful>Dl; Supplementary
Methods). In this strain, reducing the gene dosage of components of the Notch pathway by one-half
(Delta - DlRevF10, Notch receptor - NXK11, or the downstream effector eyegone —eygPxA1 (ref. 2),
significantly reduced the size of the eye tumours (data not shown). Conversely, introducing gain-offunction Notch mutations, such as the constitutively active Nintra, caused larval lethality, perhaps due to
enhanced tumourigenesis.
In turn, eye-specific overexpression of eyeful suppressed the growth
deficiency in the eye caused by reduced activity of the Notch pathway (Supplementary Table S1).
Phenotypic analysis of EP and GS P-elements in the lola and psq region
To determine the effects of individual EP lines on the Delta-induced eye overgrowth defect, each EP line
listed in Table S1 (see map in Supplementary Fig. S1) was crossed to a balanced ey-Gal4>Dl/CyO stock.
The F1 progeny of the former crosses were analysed for possible enhancement or suppression of the eye
overgrowth phenotype. To test the capacity of the EP lines and the two GS lines identified in this screen
to recover normal growth, each of the EP or GS lines was crossed to a balanced stock that has reduced
Notch pathway activity due to generalized expression of the fringe gene (ey-Gal4>fng/CyO). Two EP Pelements elements that enforce expression of the strand [+], hence in the anti-sense transcription of the
lola gene (i.e. EP2396 and EP2357) weakly enhanced the large eye defect of ey-Gal4>Dl. The two Pelement are homozygous lethal and fail to complement lola alleles and are therefore new lola alleles
Ferres-Marco et al
2
(lolaEP2396 and lolaEP2357). We reasoned that perhaps the transcription from these EP P-element might
interfere with transcription/translation of specific of the lola isoforms. This would suggest that the lola
locus harbours tumour-suppressor activity as well as oncogenic activity (Table S1).
To test the effect of individual EMS mutations induced on the eyeful chromosome, we used
balanced stocks (e.g. rev1 eyeful/CyO) and a recombinant ey-Gal4>Dl/CyO stock. The F1 progeny that
lacked the balancer chromosome were analysed for reduction of primary eye tumour size and for the
occurrence of secondary eye growths in the head, thorax, and abdomen. The individual shown in
Supplementary Fig. S2 are representative individual of each cross.
Both Lola and Psq function as epigenetic silencers in vivo
The lack of suitable psq mutations had prevented the function of Psq in epigenetic silencing in vivo from
being confirmed. For example, a deficiency called lola psq∆18 has been used as a strong psq— mutant
allele. However, this mutation inactivate psq BTB-containing transcripts but also removes lola transcripts
as well3, 4. Therefore, we re-assessed this issue.
We first determined whether Lola contributes to epigenetic silencing in vivo. To this end, we
tested whether lola— mutations could affect PcG-mediated epigenetic maintenance of gene silencing.
Heterozygous Polycomb3 (Pc3/+) flies develop an extra sex comb on the second and third legs, as well as
suffering antenna-to-leg and halter-to-wing transformations at low penetrance. These phenotypes are
caused by de-repression of the silencing of Hox genes. Indeed, enhancement or suppression of these
phenotypes has served to identify novel PcG or Trithorax Group (TrxG) members, respectively3-5.
Notably, in the Pc3/+ flies, a 50% reduction of lola gene dosage significantly increased the number of
extra sex combs (Supplementary Fig. S3a) and the same result was obtained using previously isolated
lola— mutations (Supplementary Fig. S3a). The other phenotypes of Pc3/+ flies were also enhanced by
lola— mutations (data not shown). It was also noteworthy that for unknown reasons, the parental eyeful
P-element insertion significantly suppressed the Pc3/+ phenotype (Supplementary Fig. S3a).
This
suppression masked the effect of psq— mutations (Supplementary Fig. S3a) because a psq— chromosome
without the eyeful P-element or the mutation psq0115 significantly increased the extra sex combs
phenotype in the Pc3/+ flies (Supplementary Fig. S3a).
Ferres-Marco et al
3
Together these data suggest that both Psq and Lola are members of the PcG family.
Furthermore, deregulation of Psq-Lola alone appears to be sufficient to convey epigenetic inheritance of a
silenced state (Supplementary Fig. S3b). Transposon silencing is a well-known phenomenon that is
mediated by PcG (ref. 5).
We found that Gal4-induced overexpression of psq-lola on the eyeful
chromosome caused transposon silencing, as seen by the inactivation of the mini-white gene within the
transposon (Supplementary Fig. S3b).
This transposon silencing phenotype occurred with a 50%
incidence, and occurred as well as with another ey-Gal4 line and with en-Gal4 al low penetrance (data not
shown). Transposon gene silencing was reverted by psq— or lola— mutations that also reverted the
tumourigenic phenotype (Supplementary Fig. S3c).
Methylation analyses of the RBF gene
We examined the DNA methylation of the RBF gene using two methods: (i) Methylation-sensitive
restriction enzymes analysis and direct bisulphite sequencing. We used the restriction enzymes HpaII and
MspI that are sensitive to methylation of the cytosines in the 5'-CCGG-3' recognition sequence6. While
HpaII will not cut at its recognition sequence if it contains a methylated cytosine (mCCGG), both MspI
and HpaII digestion will be blocked if both cytosines are methylated (mCmCGG).
Through this
approach, two regions around the promoter and transcription start site of the RBF gene were seen to be
susceptible to methylation. A variation of this approach involved digesting genomic DNA from the eye
discs first with HindIII and then with HpaII or MspI, and then amplifying the DNA fragments by PCR to
yield products only when the RBF region was methylated at each HpaII/MspI sites. A similar analysis
was also performed with another pair of methylation-sensitive enzymes, HhaI/PstI, and the same results
were obtained (data not shown).
We also performed direct bisulphite sequencing of genomic DNA from third instar eye discs
dissected from approximately 90-100 larvae of the genotype: ey-Gal4>eyeful>Dl, ey-Gal4>Dl, w1118 and
ey-Gal4>Dnmt2 (as controls) as described in Supplementary Methods.
Ferres-Marco et al
4
Supplementary Figure Legends
Figure S1 Both lola and psq genes are affected by eyeful. a, Detail of the first intron of lola. The insertion
and orientation of nine EP lines and two GS lines, eyeful and 71A5, isolated in this study are shown. b
and c, RT-PCR overexpression of lola (b) and psq (c). RT-PCR analysis of mRNA abundance in larvae of
the hsp70-Gal4 genotype crossed with eyeful in the absence of heat shock (—) and after 1h heat-shock
(+). PCR amplification of RT lola or psq products was performed from the common region of the lola
transcripts (b) or the psq BTB region (lower band in c) and the psq common region (upper bands in c).
Two bands were amplified from the common region of psq: an upper band of 1549 bp that presumably
corresponds to the short isoform of psq retaining intron IV (ref. 7), and a lower band of 1289 bp that
corresponds to the remaining 8 isoforms (psq-RA to RH) in which intron IV is spliced-out. In both
experiments, the main lola or psq transcripts are elevated in the induced (+) compared with the noninduced (—) larvae. The short psq isoform seems to be downregulated in the induced tissues. d-g, lola
and psq mRNA expression patterns in wild-type (WT) and ey-Gal4>eyeful mutant third-instar discs.
Mutant discs are oddly shaped when compared with WT discs, but the resulting adults have largely
normal eyes. RT-PCR experiments were performed using RNA isolated from third instar larvae collected
from GS88A8/hsp70-Gal4 heat-shocked (+) or without heat-shock (—). We noted that RT-PCR
experiments show only a modest, albeit consistent, increase in the levels of lola and psq compared with
the marked increase in these genes revealed by in situ hybridization. This apparent discrepancy is
probably due to the technique used since similar RT-PCR experiments in which the abundance of lola or
psq mRNA was analysed from eye discs of ey-Gal4/GS88A8 and w— (as wild-type control) larvae also
yielded a modest increase of the global levels of lola or psq mRNA in the mutant compared with the w—
discs (data not shown).
Figure S2. Comparative assessment of the impact of psq— or lola— mutations induced on the eyeful
chromosome in tumourigenesis. Note that a 50% reduction of endogenous psq or lola genes (in trans
Ferres-Marco et al
heterozygous with eyeful) does not suppress tumourigenesis.
5
In contrast, psq— or lola— mutations
induced on the eyeful chromosome did so. The examples depicted were chosen because they are
representative individual of each cross. The crosses were repeated at least three times for each genotype
and the F1 progeny were compared with progeny resulting from a parallel cross of the parental unmutagenised eyeful chromosome to the ey-Gal4>Dl flies. The rev5, rev6, and rev13 are new lola alleles
as assessed by molecular characterization or genetic complementation and they reduced the size of
primary eye tumours and reduced the frequency of occurrence of secondary eye growths (~1-10%). The
rev5 allele led to all secondary growths that formed in the thorax and abdomen producing necrotic masses
(arrows). This phenomenon was occasionally observed with the un-mutagenised eyeful chromosome (data
not shown) but the introduction of the lolarev5 mutation augmented the incidence of this phenotype. The
molecular lesion of lolarev5 has not yet been identified. The rev2, rev4, rev7, rev9, rev12, and rev14 are
new psq alleles as assessed by molecular characterization and all of them suppressed both the primary eye
tumours and the occurrence of secondary growths. All the molecularly characterized psq— are sterile in
trans heterozygous with deficiencies that uncover the lola and psq genes. Based on this observation, it is
possible that the rev3, rev8 and rev16 are weak lola alleles and the rev1 may be a psq allele (in this
revertant, secondary growth occurred in approximately ≤1%). We have not identified the molecular
lesions of these alleles, and therefore their classification is only tentative.
Figure S3 Mutations in the BTB region of psq or lola associated with reversion of the eyeful-induced
tumour phenotype. a, RT-PCR and direct sequencing of the psqrev9 transcript (data not shown) showed
that psqrev9 causes a mutation of the intron splice donor site (GU AU), which destroys the normal
splice donor site. The PCR-amplified fragment is 683 bp in the wild-type, whereas the splicing error
mutant psqrev9 resulted in a larger PCR amplicon of 755 bp. The retention of the 72 bp intron causes the in
frame addition of 24 amino acids within the BTB/POZ domain, presumably disrupting the conserved
BTB pocket domain which is important for dimerization. c, Schematic diagram of a zinc-finger
containing Lola variant protein showing the position of the stop codon mutation of rev6. b,
Chromatographs show the point mutation in lolarev6 (nt 32 G
A). The reading frame is shown above
the chromatographs from the wild-type (control) and the heterozygote (lolarev6/+) larvae.c, Sequence
conservation of the N-terminal of several BTB domains, including the TrxG proteins, lola-like and Trl-
Ferres-Marco et al
6
like GAGA. The positions of the psq— and lola— mutations isolated in this study are shown. Secondary
structural elements within the BTB domain of PLZF are shown below the sequence alignment. The red
and blue boxes indicate the conserved critical charged pocket residues, aspartate (D) residue at position
36 of the long Psq isoform lysine (K) at position 50 in Psq, which are important for transcriptional
repression and corepressor binding in the oncoproteins PLZF and BCL-6.
Figure S4 Both lola and psq genes encode proteins that behave as epigenetic silencers in vivo. a, The
occurrence of an extra sex comb on the second leg in heterozygous Pc3/+ males and double heterozygous
Pc3/+ and lola—/+ (or psq—/+) is plotted. The mean numbers of extra hairs in sex combs on the second
leg are shown per leg. For both Pc3/+ and double Pc3/+ and lola—/+ (or psq—/+) trans-heterozygous extra
sex comb phenotypes, the differences observed between different genotypes in pairwise comparisons and
labelled (***) are all highly significant in a posteriori Scheffe’s F tests (p<0.0001; n= 30 animals of each
genotype). b, Gal4-inducible overexpression of Psq and Lola in the eyeful GS line causes transposon gene
silencing, as seen by the clear red area (arrowhead). c, The percentage of flies that exhibit eyes with clear
areas (i.e. displaying transposon gene silencing of the mini-white gene) in the parental line (eyGal4>eyeful) and the cis-heterozygous flies with eyeful mutations in psq or lola are plotted. Note that the
best revertants of the tumour phenotype are also the best revertants of the transposon gene silencing
phenotype.
Ferres-Marco et al
7
Supplementary Methods
Drosophila husbandry and the genetic screen
For the isolation of novel tumour-initiating genes in Drosophila melanogaster we used the Gene Search
(GS) gain-of-expression system. The P-element-based GS transposon contains five tandem copies of the
Gal4 binding (upstream activating sequences -UAS-) sites capable of over- or misexpressing gene(s) that
lie either side of the GS insertion. Flies that express the ey-Gal4 and that carry the UAS-Dl (ey-Gal4>Dl)
were crossed to randomly inserted GS lines (D.F.M. and M.D. unpublished results). This co-expression
may produce no effect, suppression or enhancement of the Delta phenotype. The GS88A8 (eyeful) and
GS71A5 were isolated in such a screen. The two GS lines resulted in enhancement of the ey-Gal4>Dl
‘large eye’ phenotype, but the phenotypes were not identical. The GS71A5 showed reduced viability and
complete loss of the eye when crossed to ey-Gal4 UAS-fng, which results in a small eye phenotype due to
reduced Notch activation2, 8. Additionally, GS71A5 crossed to ey-Gal4 produced homeotic eye to head
transformations and antennae to leg transformations. When crossed to ey-Gal4, both GS lines produced
defects in retinal axon guidance probably due to the overexpression of lola transcripts. Both GS lines
crossed to ey-Gal4 exhibited transposon gene silencing.
Other mutant stocks and transgenes used were: lola5D2, lolae76 (gifts from E. Giniger), lola642P,
lolaEP2537, lolaEP2396, lolaEP2398, psqBG02315, psqKG01598, Df(2R)E3363, Df(2R)12, DlRevF10, NXK11, Rpd304556,
esc1, MS1096-Gal4 (this line drives strong expression in the dorsal compartment of the wing pouch, and a
weaker expression in the ventral region), dppblink-Gal4, and UAS-GFPnls (http://flybase.net), EP(2)2137,
lolaEP2106, lolaEP2626, lolaEP2321, lolaEP2374, lolaEP2374, psqEP2524, and psqEP2011 (from Exelixis collection),
psq0115, Df(2R) lola-psq∆18, Pc3, PcXT109 (gift from R. Mann), tlrR85 (gift from A. Schwendemann), trxE2,
ash122, and E(z)731 (gift from J. Müller), Su(var)3-917 and Su(var)3-906 (gift from G. Reuter), eygPxA1 (ref.
2), UAS-Nintra, UAS-fng and UAS-Dl, ey-Gal4, UAS-RBF, viking/collagen IV-GFP (G00454, a gift from
W. Chia), UAS-Dnmt2 (gift from L.A. Lyko).
All combinations of ey-Gal4 (or other Gal4 lines) and different GS, EP, and UAS lines and
mutants were raised at 25° C.
Ferres-Marco et al
8
GS element mapping
Genomic DNA flanking the P-element insertions in the GS88A8 and GS71A5 stocks were recovered by
inverse PCR (http://www.fruitfly.org/about/methods) and sequenced.
A BLAST search with each
sequence produced perfect matches to lola at the interval 47A11.
In situ hybridisation and antibody staining
PCR-amplified fragments were used as a template for the synthesis of lola and psq DNA probes (all
primer sequences are available on request). For immunofluorescence, the primary antibodies used were:
mAb Elav at a dilution of 1:100; mAb Dlg 1:100; mAb4D4 against Wg 1:100; mAb24B10 against
Chaoptin 1:100 (all from the Developmental Studies Hybridoma Bank); anti-phosphorylated H3-S10
1:5000 (Upstate); rabbit anti-b-galactosidase (Cappel) 1:500. The specific antibodies to detect histone tail
modifications were: rabbit ab8580 anti-trimethylated H3-K4 1:2000; mouse mAbcam 6002 antitrimethylated H3-K27 1: 200; mAbcam14222 rat anti- dimethylated H3-K27 1:1000; rabbit ab8898 antitrimethylated H3-K9 1:5000; rabbit ab12178 anti-acetylated H3-K9 1:1000 (all from Abcam). The
secondary antibodies used were Alexa Fluor-596- and -488-conjugated (Molecular Probes) and Cy5conjugated (Jackson Immunoresearch) at 1:200. Images were captured on a Leica TCS-NT Confocal
microscope.
EMS reversion mutagenesis
All revertants were induced on the eyeful (GS88A8) chromosome by mutagenesis with ethyl methanesulphonate (EMS). We mutagenised GS88A8/CyO males and ~20,000 mutant chromosomes were
screened for suppression of Gal4-induced eye phenotypes.
Initially, revertants were isolated in ey-
Gal4>Dl/GS88A8 but this combination had very reduced viability and the method was unefficient. We
then took advantage of the fact that overexpression of the endogenous lola and psq genes in GMRGal4/GS88A8 animals had rough eyes. We mutagenised GS88A8/CyO males were crossed to GMR-Gal4
virgin females and all F1 revertants were then backcrossed to the ey-Gal4>Dl strain to score: (i) the
reversion of the eye tumour phenotype, (ii) that the reversion of the phenotype was heritable and
reproducible, and (iii) to ensure that revertant mutation segregated away from the CyO balancer
Ferres-Marco et al
9
chromosome. In all, a total of 14 mutations that completely reverted or strongly suppressed the eye
phenotype were recovered. Single mutagenised GS88A8 chromosomes were then tested for lethality and
sterility in trans to either Df(2R)12 or Df(2R)E3363. The fourteen EMS-induced revertants were lethal or
semi-lethal in trans-heterozygosity with the two deficiencies of the 47A11-B1 region. The surviving
adults were either fertile or sterile and grandchildless (DFM and MD, unpublished results). Eight of these
were identified as psq mutations by their failure to complement mutant psq alleles from other
mutagenesis3, 4, 7.
To molecularly characterise the EMS-induced mutations, the coding exons of psq and most
coding exons of lola were amplified by PCR (all primer sequences are available on request) and
sequenced in each individual mutant. Heterozygous adult flies were used to obtain genomic DNA. The
sequence alignment of the different mutants was used to identify mutations and Single Nucleotide
Polymorphism (SNP) present in the parental (un-mutagenised) GS88A8 chromosome. Mutations were
identified by double peak analysis of chromatographs of the PCR fragments amplified from genomic
DNA from heterozygous flies using the Sequencher programme. PCR products amplified for genomic
DNA prepared from hemizygous (GS88A8 rev2/Df(2R)E3363) flies were also used to determine the 11pb
deletion in the rev2 allele. In addition to a virtually identical set of polymorphisms, each individual
mutation had a single base change or a small deletion as described in Fig. 3e-f. RT-PCR and direct
sequencing of the psqrev9 transcripts showed that this splicing error mutant retains the 72 bp intron
(ATGAAGTATCTCGATATATGTATCTACACTATAGTTATGAAACTAATTAAATTTCTTATTCG
AAAACTCCAG). We sequenced the wild-type intron and it also comprised 72 bp. This differs from
sequence report in FlyBase Release 3.2.
Phenotypic analyses of the suppression of the ‘eyeful’ phenotype
To facilitate the phenotypic analyses, we generated a triple mutant strain carrying the eyeful GS line, the
UAS-Dl transgene and the ey-Gal4 driver all on the same chromosome (ey-Gal4>eyeful>Dl). These flies
were sub-viable but fertile. Mutant animals underwent an extended period of larval development and
discs from five day-old larvae displayed typically hyperplasic overgrowths (data not shown). In contrast,
discs from seven to nine day-old mutant larvae showed massive uncontrolled overgrowth.
The
phenotypic analyses of the suppression of the ‘eyeful’ phenotype were established in the triple mutant and
Ferres-Marco et al
10
strains carrying well-defined loss-of-function mutations in Notch pathway components and mutations in
epigenetic regulators (histone deacetylase—Rpd304556, histone methyltransferases —Su(var)3-917, Ash122,
TrxE2, E(z)731, and PcG genes — Esc1, Pc3 and PcXT109) and the RBF gene (RBF14). Flies carrying the
triple mutant chromosome balanced over the CyO balancer were crossed to individual mutant stocks and
the progeny scored for no effect, enhancement or suppression of the eye tumour phenotype. We compared
the experimental (ey-Gal4>eyeful>Dl/+; mut/+ or ey-Gal4>eyeful>Dl/mut) progeny to the parental
chromosome (ey-Gal4>eyeful>Dl/+; +/+) and scored both penetrance and expressivity of the
suppression. Suppression mutations detected in the progeny were re-tested at least two times. We
observed macroscopically visible secondary eye growths (size ranged from 34µm to 645µm) as visualized
by the red pigments of the differentiated retinal cells in approximately 30% in flies of the eyGal4>eyeful>Dl/+ genotype. Reduced metastases in the suppressing genotypes was scored based on the
incidence of these macroscopically visible ‘secondary eye growths’ in the surviving F 1 progeny of each
cross. Nonetheless, it remained formally possible that reduced metastases in suppressing genotypes
occurred after metastasis cells failed to differentiate.
All reported interactions, including the UAS-RBF, with the ey-Gal4>eyeful>Dl flies suppressed
with a 100% penetrance, exception made for one Su(var)3-96 allele (80% penetrance with high
variability). The size of the rescued adult eyes were similar or slightly larger as ey-Gal4>Dl flies, or even
smaller than wild-type eyes. For example, in the crosses with UAS-RBF, E(z)731, Pc3, PcXT10, and
Su(var)3-917, the progeny (ey-Gal4>eyeful>Dl/+; mut/+) had at least 1 eye smaller than wild-type in a
30-70% of the animals examined. The lethality of ey-Gal4>eyeful>Dl flies was severely increased by
introducing one mutant copy of Rpd304556, despite the fact that the Rpd304556 is a hypomorphic allele of
Rpd3. In this combination, a reduced number of F1 progeny was scored (n=26). The enhancement of the
ey-Gal4>eyeful>Dl phenotype by RBF mutation (RBF14) was consistently seen in the F1 progeny scored.
Excisions of GS88A8 line
The GS88A8 (eyeful) line is homozygous lethal. To recover precise excisions of the GS88A8 P-element
line in chromosomes carrying psq mutations, we mobilised the GS88A8 (marked with w+) with the ∆2-3
transposase and approximately 300 w— males were analysed for lethality over the parental GS88A8. All
Ferres-Marco et al
11
but one of the stocks were lethal in trans to the parental (unmutagenised) GS88A8 chromosome, the
eyeful GS (∆11) line carried the psqrev14.
Bisulphite and methylation analysis using enzyme digestion and PCR
Genomic DNA was isolated from third instar eye discs or larvae of the following genotypes: eyGal4>eyeful>Dl; ey-Gal4>Dl, w1118 and ey-Gal4>Dnmt2 (as controls), and the DNA was digested
overnight with HindIII.
To design the primers and for the CpG island predictions we used
http://www.urogene.org/methprimer.
We performed the bisulphite modifications using the protocol
described in ref. 9. The modified DNA was subjected to two rounds of amplification with primers
designed using the MethPrimer program from the same promoter region analysed in the restriction
analysis. The amplified DNA was cloned into the pSTBlue acceptor vector (Novagen). Then from 13
independent colonies picked in each case, the sequence of the promoter was determined in each plasmid,
and the extent of methylation examined by determining the number and position of methylated cytosine
residues.
For methylation analysis via enzyme digestion and PCR, DNA was first digested with HindIII
and then with HpaII or MspI. Digested DNA was subsequently subjected to PCR amplification and
undigested DNA was used as a control for the PCR reaction. We investigated the methylation status of
the RBF promoter region (site p) and the first exon (site e) using gene-specific primers. As a control of
the transcribed gene, we investigated the first exon of psq. All reactions were carried out over 35
amplification cycles and the samples were analysed in 1% agarose/TAE gels.
References of Supplementary Information
1.
Artavanis-Tsakonas, S., Rand, M. D. & Lake, R. J. Notch signaling: cell fate control and signal integration in
development. Science 284, 770-6 (1999).
2.
Dominguez, M., Ferres-Marco, D., Gutierrez-Avino, F. J., Speicher, S. A. & Beneyto, M. Growth and specification of
the eye are controlled independently by Eyegone and Eyeless in Drosophila melanogaster. Nat. Genet. 36, 31-9 (2004).
3.
Schwendemann, A. & Lehmann, M. Pipsqueak and GAGA factor act in concert as partners at homeotic and many other
loci. Proc Natl Acad Sci U S A 99, 12883-8 (2002).
4.
Huang, D. H., Chang, Y. L., Yang, C. C., Pan, I. C. & King, B. pipsqueak encodes a factor essential for sequencespecific targeting of a polycomb group protein complex. Mol. Cell. Biol. 22, 6261-71 (2002).
5.
Ringrose, L. & Paro, R. Epigenetic regulation of cellular memory by the Polycomb and Trithorax group proteins. Annu.
Rev. Genet. 38, 413-43 (2004).
Ferres-Marco et al
12
6.
McClelland, M., Nelson, M. & Raschke, E. Effect of site-specific modification on restriction endonucleases and DNA
modification methyltransferases. Nucleic Acids Res. 22, 3640-59 (1994).
7.
Weber, U., Siegel, V. & Mlodzik, M. pipsqueak encodes a novel nuclear protein required downstream of seven-up for
the development of photoreceptors R3 and R4. EMBO J. 14, 6247-57 (1995).
8.
Dominguez, M. & de Celis, J. F. A dorsal/ventral boundary established by Notch controls growth and polarity in the
Drosophila eye. Nature 396, 276-8 (1998).
9.
Olek, A., Oswald, J. & Walter, J. A modified and improved method for bisulphite based cytosine methylation analysis.
Nucleic Acids Res. 24, 5064-6 (1996).