Download ANSWERS TO REVIEW QUESTIONS

Survey
yes no Was this document useful for you?
   Thank you for your participation!

* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project

Document related concepts

Expanded genetic code wikipedia, lookup

Genetic code wikipedia, lookup

Point mutation wikipedia, lookup

Artificial gene synthesis wikipedia, lookup

Genome (book) wikipedia, lookup

Microevolution wikipedia, lookup

Designer baby wikipedia, lookup

Gene expression programming wikipedia, lookup

Gene wikipedia, lookup

Saethre–Chotzen syndrome wikipedia, lookup

Neuronal ceroid lipofuscinosis wikipedia, lookup

Nutriepigenomics wikipedia, lookup

Site-specific recombinase technology wikipedia, lookup

Population genetics wikipedia, lookup

Genome evolution wikipedia, lookup

Epistasis wikipedia, lookup

Protein moonlighting wikipedia, lookup

Therapeutic gene modulation wikipedia, lookup

NEDD9 wikipedia, lookup

Helitron (biology) wikipedia, lookup

Epigenetics of neurodegenerative diseases wikipedia, lookup

Cancer epigenetics wikipedia, lookup

Cell-free fetal DNA wikipedia, lookup

Gene therapy of the human retina wikipedia, lookup

Mutation wikipedia, lookup

Mutagen wikipedia, lookup

Microsatellite wikipedia, lookup

Frameshift mutation wikipedia, lookup

DNA damage theory of aging wikipedia, lookup

Oncogenomics wikipedia, lookup

Transcript
ANSWERS TO REVIEW QUESTIONS
CHAPTER 12
1. A mutation occurs in less than 1 percent of the population. A SNP occurs in more than 1
percent of the population.
2. A germinal mutation occurs in a gamete or a fertilized ovum, and therefore affects all the cells
of an individual and is more serious than a somatic mutation, which affects only some tissues
and is not transmitted to future generations.
3. Collagen’s conformation and assembly is very precise and sensitive to disruption by slight
alterations.
4. Gaucher disease is a metabolic disorder that causes fat buildup in bone marrow, liver, and
spleen and Parkinson disease is a neurodegenerative movement disorder. Both can be
caused by deficiency of an enzyme, glucocerebrosidase.
5. A spontaneous mutation can arise if a DNA base is in its rare tautomeric form at the instant
when the replication fork arrives. A wrong base inserts opposite the rare one.
6. Alpha and beta rays do not often harm health unless inhaled or eaten. Gamma radiation can
penetrate the body, damaging tissues.
7. Mutational hot spots are direct repeats or symmetrical regions of DNA.
8. Frameshift, deletion, duplication, insertion, transposable element
9. a. A degenerate codon
b. A mutation that replaces an amino acid with a structurally similar one
c. A mutation that replaces an amino acid in a nonessential part of the protein
d. A mutation in an intron
10. A jumping gene can disrupt gene function by altering the reading frame or shutting off
transcription.
11. The gene is expanding.
12. Short repeats can cause mispairing during meiosis. Long triplet repeats add amino acids,
which can disrupt the encoded protein's function, often adding a function. Repeated genes
can cause mispairing in meiosis and have dosage-related effects.
13. Copy number variants (CNVs) differ by the number of copies of genes. Missense mutations
are single DNA base pair changes that alter the amino acid sequence of a peptide.
14. Retention of an intron and expanding triplet repeats may provide a new function for a gene,
which may cause disease.
15. Mutations in the 3rd codon position can be silent. Mutations in the 2nd position may replace
an amino acid with a similarly-shaped one. 61 codons specify 20 amino acids.
16. A conditional mutation is only expressed under certain conditions, such as increased
temperature or exposure to particular drugs or chemicals.
17. Excision repair corrects ultraviolet-induced pyrimidine dimers. Mismatch repair corrects
replication errors. They use different enzymes.
1
18. The parental DNA strand is retained in the stem cell.
ANSWERS TO APPLIED QUESTIONS
1. a. AUGUCGUCAAAAGCAUGGCGGCCA, substitutes serine for leucine.
b. AUGUAGUCAAAAGCAUGGCGGCCA, changes second codon to a stop codon.
c. AUGAAUUGUCAAAAGCAUGGCGGCCA, shifts reading frame.
d. AUGUUAUCAAAAGCAUGGCGGCCA, no consequence
e. AUGUUCUCAAAAGCAUGGCGGCCA, substitutes phenylalanine for leucine.
f. AUGUUAUCAAAAGCAUGGCGGCCA, no consequence
g. AUGUUGUCAAAAGCAUGGCGGCCAAUGUUGUCAAAAGCAUGGCGGCCA
h. AUGUGUCAAAAGCAUGGCGGCCA, shifts reading frame.
2. The frameshift mutation can create a stop codon, leading to a shortened polypeptide.
3. Any change that produces UAA, UAG, or UGA
4. a. Methionine-Threonine–Histidine-Arginine-Cysteine-Serine-Leucine-Arginine
b. Methionine-Threonine–Histidine-Serine-Cysteine-Serine-Leucine-Arginine
c. A nonsense mutation that causes a premature stop and shortens the peptide.
d. A frameshift mutation changes the sequence and creates a premature stop.
e. Insertion of two bases in a row
5. GAU to AAU or GAC to AAC
6. The second boy's second mutation, further in the gene, restores the reading frame so that
part of the dystrophin protein has a normal structure, providing some function.
7. Asn to lys: AAU to AAA AAC to AAG
ile to thr: AUU to ACU AUC to ACC AUA to ACA
8. a. GCG to GAC or GGU to GAU
b. missense
9. The drug causes a tRNA bearing an amino acid to bind to a “stop” codon, enabling the part of
the mRNA past the stop codon to be translated. A full protein is made. Such an effect could be
used to “read through” stop codons in the middle of genes that cause diseases.
10.
Nonsense
11.
Arg to his: CGU to CAU or CGC to CAC
12. The repair enzymes could correct UV-induced pyrimidine dimers.
ANSWERS TO WEB ACTIVITIES
1. a. de novo, because it is not in parents
b. The mutation creates an intron splice site
c. Emery-Dreifuss muscular dystrophy, dilated cardiomyopathy, Dunnigan-type familial
partial lipodystrophy, limb girdle muscular dystrophy, obesity, Charcot-Marie-Tooth
disease.
2
2. Beneficial: identification of fatal “double dominants.” Harmful: screening and termination of all
affected pregnancies.
3. Answers vary with image selected. Albinism causes white hair, very pale skin, and red irises.
4.
Repeat disease
fragile X syndrome
Friedrich ataxia
Haw River syndrome
Jacobsen syndrome
spinal + bulbar muscular atrophy
spinocerebellar ataxia
Repeat
CGG or CCG
GAA
CAG
CGG
CAG
CAG
Normal #
6-50
6-29
7-25
11
14-32
4-44
Disease #
200-2,000
200-900
49-75
100-1,000
40-55
40-130
ANSWERS TO FORENSICS FOCUS
1. Somatic mutation
ANSWERS TO CASE STUDIES AND RESEARCH RESULTS
1. Keyshauna’s case is more severe because she has short CFTR proteins in all her cells,
whereas Latika is missing part of the protein in some cells.
2. Marshall and Angela shouldn't be concerned, because they have mutations in two different
genes.
3. a. Autosomal recessive. Both sexes are affected and it skips generations.
b. Consanguinity. Blood relatives share alleles inherited from common ancestors increasing
the risk of passing the same recessive alleles to children
c. No difference in the amino acids.
4. The second amino acid is proline in healthy members and eucine in those with heart failure.
5. Helpful: early identification so that individualized treatments can begin early. Ability to make
lifestyle changes and limit environmental exposures that increase risks. Harmful: may subject
individuals to stigmatization, genetic discrimination or emotional harm.
3