Download Mock Exam 3 Chapters 14-18 Anthony Todd http

Mock Exam 3
Chapters 14-18
Anthony Todd
[email protected]
http://by123si.yolasite.com/
1. Which of the following is incorrectly paired?
a. Alleles – alternate forms of the same gene
b. Locus – location of a gene on a chromosome
c. Genotype – the exact identity of the genes
d. Phenotype – how the genes are expressed
e. None of the above
2. All of the following are true EXCEPT:
a. Homozygous organisms have the same alleles
b. Homozygous organisms are true-breeding
c. Heterozygous organisms have different alleles
d. Heterozygous organisms are true-breeding
e. All are true
3. Mendels’ Law of Segregation states:
a. Unlinked genes will segregate independently of each other pair during gamete
formation
b. Two alleles in a pair segregate into different gametes during gamete formation
c. Two genes of an allele will segregate into different gametes during meiosis to ensure all
possible combinations of genes
d. Linked genes segregate independently of each other during gamete formation through
the process of crossing-over
e. None of the above
4. Mendels’ Law of Independent Assortment states:
a. Unlinked genes will segregate independently of each other pair during gamete
formation
b. Two alleles in a pair segregate into different gametes during gamete formation
c. Two genes of an allele will segregate into different gametes during meiosis to ensure all
possible combinations of genes
d. Linked genes segregate independently of each other during gamete formation through
the process of crossing-over
e. None of the above
5. T/F: Incomplete dominance shows that blending happens in nature.
6. Linked genes:
a. Are always inherited together
b. Follow Mendel’s Law of Independent Assortment
c. Cause polygenic traits
d. May be separated by crossing-over in Prophase II
e. None of the above
7. Two rabbits with the genotype AaBb are crossed. “A” is the allele for long ears, and “B” is the
allele for long legs. Which of the following is true?
a. The genotypic ratio of the offspring will be 1 AABB : 2 AaBb : 1 aabb
b. The phenotypic ratio of the offspring will be 9 long-legged, long-eared : 3 long-leged,
short-eared : 3 short-legged, long eared : 1 short-legged, short-eared
c. All of the offspring will be AaBb with long ears and long legs
d. The genotypic ratio of the offspring will be 9 long-legged, long-eared : 3 long-leged,
short-eared : 3 short-legged, long eared : 1 short-legged, short-eared
e. None of the above
8. If the phenotypic ratio of a genetic cross is 9:7…
a. This is an example of pleiotropy
b. This is an example of polygenic traits
c. This is an example of epistasis
d. This is an example of codominance
e. This is an example of incomplete dominance
9. Marfan Syndrome is a problem with connective tissue. It is often expressed through large hands,
feet, and height. This is an example of:
a. Autosomal recessive disorder
b. Autosomal dominant disorder
c. Epistasis
d. Pleiotropy
e. Polygenic traits
10. Blue sclera is caused by the incorrect amount, tone, and distribution of eye pigments, resulting
in the white of the eye (the sclera) to be tinged blue. It is expressed in 90% of individuals with
the gene. Therefore, its _____________ is a blue sclera and its _____________ is 90%.
a. Expressivity; penetrance
b. Penetrance; expressivity
c. Modifier gene; expressivity
d. Modifier gene; penetrance
e. Expressivity; affliction rate
11. An average-sized male marries a female with achondroplasia. What are their chances of having a
child with achondroplasia?
a. 0%
b. 25%
c. 50%
d. 75%
e. 100%
12. All of the following are autosomal recessive conditions EXCEPT:
a. Albinism
b. Cystic fibrosis
c. Sickle-cell anemia
d. Hypercholesterolemia
e. Phenylketonuria
13. The genes for red-hair and weakness (no offense to any redheads taking this test) are linked. If
they become unlinked, the result is Chuck Norris. Out of a small population of 200 people, there
are two Chuck Norrises. What is the recombination frequency illustrated by this situation?
a. 1/100
b. 1/101
c. 200/2
d. 202/2
e. 0/200
14. In males, the Y chromosome carries the SRY gene. This gene codes for a testis. The testis
synthesizes:
a. Testosterone which ensures that the Mullerian ducts are kept so internal male parts can
be made
b. AMH which ensures that Wolffian ducts are removed so male development can
continue
c. MIH which inhibits the formation of Mullerian ducts so male development can continue
d. A and B are correct
e. B and C are correct
Use the following information for Questions 15 and 16:
A dominant sex-linked gene B produces white bars on black chickens. A clutch of chickens has equal
numbers of black and barred chicks.
15. If only the females are found to be black. What were the genotypes of the parents?
a. Male: ZbZb; Female: ZbW
b. Male ZBZb; Female: ZbW
c. Male: ZBZb; Female: ZBW
d. Male: ZbZb; Female: ZBW
e. None of the above
16. If the males and females are evenly represented in the black and barred chicks, what were the
genotypes of the parents?
a. Male: ZbZb; Female: ZbW
b. Male ZBZb; Female: ZbW
c. Male: ZBZb; Female: ZBW
d. Male: ZbZb; Female: ZBW
e. None of the above
17. Which of the following is not paired correctly?
a. Agammaglobulinemia – sex-linked disorder
b. Albinism – autosomal recessive disorder
c. Polydactyly – autosomal recessive disorder
d. Turner’s Syndrome – sex chromosome abnormality
e. None of the above
18. In an individual with Jacob’s Syndrome, how many Barr bodies could a scientist expect to find
from a cheek swab?
a. 0
b. 1
c. 2
d. 3
19. What is indicated when a single-character testcross yields offspring that all have the dominant
phenotype?
a. The parent with the dominant phenotype was homozygous
b. The parent with the dominant phenotype was heterozygous
c. Epistasis has occurred
d. The alleles are codominant
e. Both parents are heterozygous
20. A man who has type B blood and a woman who has type A blood could have children of which of
the following phenotypes?
a. A and B
b. A, B, and AB
c. AB
d. A, B, AB, and O
e. None of the above
21. During Meiosis II, nondisjunction occurs. What are the chances of having a normal gamete
formed?
a. 0%
b. 25%
c. 50%
d. 75%
e. 100%
22. All of the following are alterations of chromosomes EXCEPT:
a. Deletion
b. Duplication
c. Deactivation
d. Inversion
e. Reciprocal translocation
23. A 20-year-old woman has a child with Down syndrome. What was the most likely cause?
a. Nondisjunction
b. Deletion
c. Translocation
d. Monosomy
e. Triploidy
24. Griffith’s experiment helped prove which of the following?
a. DNA is the genetic material
b. Protein is the genetic material
c. Thymine and adenine are present in equal quantities, and cytosine and guanine are
present in equal quantities
d. Genotype and phenotype can change by taking in external DNA from another cell
e. DNA is made up of nucleotides
25. When DNA duplicates, what happens to the old DNA?
a. Both old strands are kept together and the two new strands pair up
b. One old strand pairs up with one new strand
c. Parts of the new and old strands mix together to form the new DNA
d. It is destroyed by the cell and two new strands of DNA are destroyed
26. Which of the following is paired incorrectly?
a. Topoisomerase – relieves the stress of DNA unzipping
b. Helicases – unwind DNA by breaking phosphodiester bonds
c. Single strand binding proteins – hold the DNA strand apart
d. DNA polymerase – makes the complementary DNA strand
e. None of the above
27. T/F: DNA polymerase only adds to the 5’ end pf the new strand.
28. A woman with hemophilia marries a man who does not have hemophilia. What is the probability
that one of their children will have hemophilia?
a. 0%
b. 25%
c. 50%
d. 75%
e. 100%
29. Which enzyme is responsible for “proofreading” DNA by removing mistakes?
a. DNA polymerase
b. Telomerase
c. DNA ligase
d. Okaziase
e. Nuclease
30. Which of these is the correct sequence of enzymes used in the synthesis of the lagging strand of
DNA?
a. Primase, helicase, DNA polymerase, ligase
b. Helicase, primase, ligase, DNA polymerase
c. Helicase, primase, DNA polymerase, ligase
d. Helicase, DNA polymerase, primase, ligase
e. Ligase, primase, DNA polymerase, helicase
31. All of the following are stop codons EXCEPT:
a. UAA
b. UGA
c. UGG
d. UAG
32. During pre-mRNA processing, a __________ is put on the 3’ end of the mRNA and a ________ is
put on the 5’ end of the mRNA.
a. Cap; poly-A tail
b. Poly-A cap; poly-A tail
c. Poly-A cap; tail
d. Tail; poly-A cap
e. Poly-A tail; cap
33. The function of which of the following defies the previously held idea that “all biological
catalysts are proteins”?
a. Ribozymes
b. snRNA
c. mRNA
d. Both A and B
e. None of the above
34. In which of the following would you expect to find a Barr body?
a. An ovum of a woman
b. A sperm of a man
c. A liver cell of a man
d. A liver cell of a woman
e. A mitochondrion
35. During DNA replication, DNA polymerase only adds nucleotides to the _____ end of the leading
strand and the _____ end of the lagging strand.
a. 3’; 5’
b. 5’; 5’
c. 5’; 3’
d. 3’; 3’
e. None of the above
Use the DNA strand presented below to answer question 35.
3’ GGTACGTGCCCATGCGCATTG 5’
36. What is the DNA compliment to the piece of DNA?
a. 5’ GGTACGTGCCCATGCGCATTG 3’
b. 5’ CCATGCACGGGTACGCGTAAC 3’
c. 3’ CCATGCACGGGTACGCGTAAC 5’
d. 5’ GGUACGUGCCCAUGCGCAUUG 3’
e. 3’ CCAUGCACGGGUACGCGUAAC 5’
37. T/F: Transcription and translation can occur simultaneously in a prokaryotic cell.
38. Which of the following is NOT a part of transcription?
a. The promoter binds to the TATA box and begins transcription
b. RNA polymerase continues to add complementary bases
c. The bases are added from 5’ to 3’
d. The polymerase reaches a stop codon and stops transcription
e. All of the above are correct
39. What is the purpose of aminacyl tRNA synthetase?
a. Attach amino acids to the growing peptide chain during translation
b. Help hydrolyze the growing peptide chain as tRNA moves from the A site to the P site
c. Attach an amino acid to tRNA
d. Synthesize tRNA
e. Initiate translation
40. The P site of a ribosome does which one of the following?
a. It holds the tRNA that is carrying the next amino acid to be added to the growing
polypeptide chain
b. It holds the tRNA carrying the growing polypeptide chain.
c. It helps “unzip” DNA during transcription
d. It catalyzes the addition of amino acids to the tRNA
41. Place the following events in the synthesis of a polypeptide in the proper order.
I.
The peptide bond forms
II.
An activated tRNA matches its anticodon to the codon in the A site.
III.
A tRNA translocates from the A to the P site, and an unattached tRNA leaves the
ribosome from the E site
IV.
The large subunit attaches to the small subunit, with the initiator tRNA in the P site.
V.
A small subunit binds to an mRNA and an initiator tRNA
a. IV, V, III, II, I
b. IV, V, II, I, III
c. V, IV, III, II, I
d. V, IV, I, II, III
e. V, IV, II, I, III
42. How do cells make a lot of a single protein?
a. Positive control
b. Polysomes
c. Frameshifts
d. Increase temperature
43. All of the following mutations are harmful to the cell EXCEPT:
a. Nonsense
b. Missense
c. Silent
d. Frameshift
e. Point
44. An operon that is usually off is ____________.
a. An inducible operon
b. A repressible operon
c. Deactivated by an inducer
d. Both A and C
e. None of the above
45. T/F: The lac operon makes its repressor in an active form.
46. Which of the following would not correspond with the lac operon?
a. Glucose levels decrease so lactose binds to the repressor and turns on the operon
b. RNA polymerase binds to the promoter and begins transcription
c. Glucose levels rise and the repressor binds to the operator, turning off the operon
d. It is a catabolic system
e. All are correct
47. Which of the following are ways to increase gene expression?
I.
histone acetylation
II.
methylation
III.
phosphorylation
a. I only
b. III only
c. I and II
d. I and III
e. I, II, and III
48. What are control elements found thousands of nucleotides upstream or downstream of a gene?
a. Transcription factors
b. Enhancers
c. Promoters
d. Activators
e. Operators
49. Which of the following is not a way that genes can be regulated by translation?
a. Binding to a ribosome can be blocked
b. The protein can be made in an inactive form
c. Protein can be broken down as soon as it is made
d. The mRNA code can be altered
50. T/F: Alternative RNA splicing uses the same primary transcript, but is able to produce different
mRNA depending on which pieces are treated as introns and exons.