* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Download ANSWERS TO REVIEW QUESTIONS
Holliday junction wikipedia , lookup
Eukaryotic transcription wikipedia , lookup
Gene expression wikipedia , lookup
DNA barcoding wikipedia , lookup
DNA sequencing wikipedia , lookup
Comparative genomic hybridization wikipedia , lookup
Agarose gel electrophoresis wikipedia , lookup
Silencer (genetics) wikipedia , lookup
Transcriptional regulation wikipedia , lookup
Maurice Wilkins wikipedia , lookup
Community fingerprinting wikipedia , lookup
Gel electrophoresis of nucleic acids wikipedia , lookup
DNA vaccination wikipedia , lookup
Biosynthesis wikipedia , lookup
Transformation (genetics) wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
Molecular evolution wikipedia , lookup
Molecular cloning wikipedia , lookup
Bisulfite sequencing wikipedia , lookup
Non-coding DNA wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
ANSWERS TO REVIEW QUESTIONS CHAPTER 9 1. A pentose sugar, nitrogenous base and phosphate group 2. The nitrogenous bases in purines have a two-ringed structure while those in pyrimidines have a single-ring structure. 3. DNA must be replicated so that a complete set of genetic instructions is passed to daughter cells when a cell divides. 4. Such a molecule would bulge where purines paired with each other, yet be narrow where pyrimidines pair with each other. 5. The nucleotide base sequence encodes information. 6. One end of a strand of nucleotides has a phosphate group attached to the 5' carbon of deoxyribose. The other end has a hydroxyl group attached to the 3' carbon. Phosphodiester bonds (which bind the sugar-phosphate backbone) form between the 3' OH of the nucleotide chain and the 5' phosphate of an incoming nucleotide. Thus the chain grows in the 5' to 3' direction. The two strands are antiparallel one strand is 5'-3' and the other is 3'-5'. 7. 1 E, 2 C, 3 D, 4 B, 5 A 8. Helicases, primase, DNA polymerase, ligase 9. They are organized into nucleosomes, which then are further compacted into chromatin. 10. Histone protein, nucleosome, chromatin 11. Helicase unwinds DNA and binding proteins stabilize it. 12. Strands separate and are held apart. Primase makes RNA primer. DNA polymerase adds DNA bases to RNA primer. Proofreading repair. Continuous on one strand only. RNA primers removed. Ligase seals sugar-phosphate backbone. 13. Because the two strands are antiparallel 14. RNA forms a primer to which DNA polymerase can bind. 15. Hershey and Chase showed that DNA is the genetic material and protein is not. Meselson and Stahl showed that DNA replication is semiconservative, but not conservative or dispersive. 16. Downloading a document is similar to DNA replication because the original information persists, but is dissimilar in that not all information is reproduced and downloading is not based on complementarity. ANSWERS TO APPLIED QUESTIONS 1. The sugar-phosphate backbone of replicating DNA cannot attach. 2. Primase, DNA polymerase, helicase, binding proteins, and ligase are required for DNA replication. These are all proteins. 1 3. Lacking DNA polymerase makes life impossible, because cells cannot divide. 4. a. A G C T C T T A G A G C T A A b. G G C A T A T C G G C C A T G c. T A G C C T A G C G A T G A C 5. Answers vary. Determining the structure of DNA led to discoveries of the mechanism of heredity, and applies to all species. Sequencing the human genome applies only to us and has so far helped researchers more than it has led to treatments. 6. The film GATTACA depicts a society based on knowing genome sequences. Crime television shows such as the Law and Order and CSI programs regularly use forensic DNA testing, which compares one or two dozen selected sites in the human genome to rule out suspects. 7. Several indigenous peoples have objected to DNA collected for study of one trait that is subsequently used to study another, without further permission. This happened to the Havasupai Indians who gave DNA for diabetes testing, which was then used in a schizophrenia study. DNA testing can help people locate relatives, such as in paternity tests. 8. A gene is a segment of DNA containing the information to specify a sequence of amino acids in a protein. ANSWERS TO WEB ACTIVITIES 1. a. Opinion. The yellow sea horse, so we can learn how to enable males to carry fetuses! b. Answers vary. One example might be: Yes, to protect all endangered species. c. Stored DNA is not enough to regenerate an animal. Two copies of the entire genome must be in an egg that continues development. Stored DNA might be methylated in ways that block the expression of some genes necessary for early development. 2. Position 61290 is TCTCTTCTTTTAGTTCTTCG AGAGAAGAAAATGAAGAAGC. The complement is ANSWERS TO CASE STUDIES AND RESEARCH RESULTS 1. a. Germline transmission of the virus b. It is universal 2. No, because the phosphorus in DNA does not encode information. 2