* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Download MB206_fhs_lnt_001.1_AT_May09
Messenger RNA wikipedia , lookup
RNA polymerase II holoenzyme wikipedia , lookup
Bisulfite sequencing wikipedia , lookup
Epitranscriptome wikipedia , lookup
Eukaryotic transcription wikipedia , lookup
Gel electrophoresis of nucleic acids wikipedia , lookup
Real-time polymerase chain reaction wikipedia , lookup
Genetic engineering wikipedia , lookup
Two-hybrid screening wikipedia , lookup
Promoter (genetics) wikipedia , lookup
Genetic code wikipedia , lookup
Community fingerprinting wikipedia , lookup
Endogenous retrovirus wikipedia , lookup
Molecular cloning wikipedia , lookup
Genomic library wikipedia , lookup
Point mutation wikipedia , lookup
Transformation (genetics) wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
Biosynthesis wikipedia , lookup
Silencer (genetics) wikipedia , lookup
Gene expression wikipedia , lookup
Transcriptional regulation wikipedia , lookup
Non-coding DNA wikipedia , lookup
DNA supercoil wikipedia , lookup
Nucleic acid analogue wikipedia , lookup
Organization of bacterial chromosome Prokaryotic DNA replicate, transcription & translation by Angelia Teo (May 09) 1 Bacterial chromosome, structure & organization Prokaryotic DNA replication, transcription, translation Prokaryotic regulation of gene expression Mutations and Selection Extra-chromosomal elements. - Bacteriophages - Plasmid DNA by Angelia Teo (May 09) 2 by Angelia Teo (May 09) 3 the genome of prokaryotes is not in a separate compartment, haploid. Single chromosome: it is located in the cytoplasm (although sometimes confined to a particular region called a “nucleoid”). Prokaryotes contain no membrane-bound organelles; their only membrane is the membrane that separates the cell form the outside world. Nearly all prokaryotes are unicellular. Eukaryotes are defined as having their genetic material enclosed in a membrane-bound nucleus, separate from the cytoplasm. In addition, eukaryotes have other membrane-bound organelles such as mitochondria, lysosomes, and endoplasmic reticulum. almost all multicellular organisms are eukaryotes. by Angelia Teo (May 09) 4 Prokaryotes are haploid, and they contain a single circular chromosome. In addition, prokaryotes often contain small circular DNA molecules called “plasmids”, that confer useful properties such as drug resistance. Only circular DNA molecules in prokaryotes can replicate. Eukaryotes are often diploid, and eukaryotes have linear chromosomes, usually more than 1. by Angelia Teo (May 09) 5 In prokaryotes, translation is coupled to transcription: translation of the new RNA molecule starts before transcription is finished. In eukaryotes, transcription of genes in RNA occurs in the nucleus, and translation of that RNA into protein occurs in the cytoplasm. The two processes are separated from each other. by Angelia Teo (May 09) 6 Bacteria review one-celled organisms prokaryotes reproduce by mitosis ▪ binary fission rapid growth ▪ generation every ~20 minutes ▪ 108 (100 million) colony overnight! dominant form of life on Earth incredibly diverse by Angelia Teo (May 09) 7 Single circular chromosome haploid naked DNA ▪ no histone proteins ~4 million base pairs ▪ ~4300 genes ▪ 1/1000 DNA in eukaryote by Angelia Teo (May 09) 8 No nuclear membrane chromosome in cytoplasm transcription & translation are coupled together ▪ no processing of mRNA no introns but Central Dogma still applies ▪ use same genetic code by Angelia Teo (May 09) 9 Molecules of double-stranded DNA Usually circular Tend to be shorter Contains a few thousand unique genes Mostly structural genes Single origin of replication by Angelia Teo (May 09) 10 The bacterial chromosome is found in region called the nucleoid (not membrane-boundedso the DNA is in direct contact with the cytoplasm) by Angelia Teo (May 09) 11 by Angelia Teo (May 09) 12 by Angelia Teo (May 09) 13 by Angelia Teo (May 09) 14 Bacterial Genome is haploid, single chromosome The circularity of the bacterial chromosome was elegantly demonstrated by electron microscopy in both Gram negative bacteria (such as Escherichia coli) and Gram positive bacteria (such as Bacillus subtilis). Bacterial plasmids were also shown to be circular. Linear chromosomes found in Gram-positive Borrelia & Streptomyces. Not all bacteria have a single circular chromosome: some bacteria have multiple circular chromosomes, and many bacteria have linear chromosomes and linear plasmids. by Angelia Teo (May 09) 15 Bacterial chromosomal DNA is usually a circular molecule that is a few million nucleotides in length Escherichia coli 4.6 million base pairs Haemophilus influenzae 1.8 million base pairs A typical bacterial chromosome contains a few thousand different genes Structural gene sequences (encoding proteins) account for the majority of bacterial DNA The nontranscribed DNA between adjacent genes are termed intergenic regions by Angelia Teo (May 09) 16 by Angelia Teo (May 09) 17 Chromosomal Map of Bacteria Circular genetic map of E coli. Positions of representative genes are indicated on inner circle. Distances between genes are calibrated in minutes, based on times required for transfer during conjugation. Position of threonine (thr) locus is arbitrarily designated as 0 minutes, and other assignments are relative to thr. by Angelia Teo (May 09) 18 The Complete Sequence of Escherichia coli Chromosome by Angelia Teo (May 09) 19 Most, but not all, bacterial species contain circular chromosomal DNA. A typical chromosome is a few million base pairs in length. Most bacterial species contain a single type of chromosome, but it may be present in multiple copies. Several thousand different genes are interspersed throughout the chromosome. One origin of replication is required to initiate DNA replication. Short repetitive sequences may be interspersed throughout the chromosome. by Angelia Teo (May 09) 20 by Angelia Teo (May 09) 21 Typical bacterial chromosome must be compacted about 1,000-fold Bacterial DNA is not wound around histone proteins to form nucleosomes Proteins important in forming loop domains Compacts DNA about 10-fold DNA supercoiling Topoisomerases twist the DNA and control degree of supercoiling by Angelia Teo (May 09) 22 by Angelia Teo (May 09) 23 by Angelia Teo (May 09) 24 by Angelia Teo (May 09) 25 The length of a typical bacterial operon (usually about 3 genes), is about as long as the entire bacterial cell ! by Angelia Teo (May 09) 26 by Angelia Teo (May 09) 27 The operon model of prokaryotic gene regulation was proposed by Fancois Jacob and Jacques Monod. The lac operon is an operon required for the transport and metabolism of lactose in Escherichia coli and some other enteric bacteria. It consists of three adjacent structural genes, a promoter, a terminator, and an operator. The lac operon is regulated by several factors including the availability of glucose and of lactose. The regulator does not have to be adjacent to other genes in the operon. If the repressor protein is removed, transcription may occur. by Angelia Teo (May 09) 28 Operons are either inducible or repressible according to the control mechanism. Seventy-five different operons controlling 250 structural genes have been identified for E. coli. Both repression and induction are examples of negative control since the repressor proteins turn off transcription. by Angelia Teo (May 09) 29 by Angelia Teo (May 09) 30 DNA molecules that replicate as discrete genetic units in bacteria are called replicons. Extrachromosomal replicons: - bacteriophages - plasmids (non-essential replicons) These determine resistance to antimicrobial agents or production of virulence factors. by Angelia Teo (May 09) 31 by Angelia Teo (May 09) 32 Bacteriophage (from 'bacteria' and Greek φάγειν phagein "to eat") is any one of a number of viruses that infect bacteria. The term is commonly used in its shortened form, phage. by Angelia Teo (May 09) 33 A plasmid is an extra-chromosomal DNA molecule separate from the chromosomal DNA which is capable of replicating independently of the chromosomal DNA. In many cases, it is circular and double-stranded. Plasmids usually occur naturally in bacteria, but are sometimes found in eukaryotic organisms. by Angelia Teo (May 09) 34 by Angelia Teo (May 09) 35 by Angelia Teo (May 09) 36 They are haploid (no masking). Only 1 set of genes New generation is produced every 20 mins Advantages Easy to grow in ENORMOUS NUMBERS by Angelia Teo (May 09) Individual members of these large populations are GENETICALLY IDENTICAL 37 Genetic material of bacteria is DNA. DNA must replicate accurately so that progeny inherit all of the specific genetic determinants (genotype) of the parental organism. by Angelia Teo (May 09) Bacterial viruses (bacteriophages) have DNA or RNA as genetic material. Specific DNA expression under a particular set of growth conditions determines the observable characteristics (phenotype) of the organism. 38 by Angelia Teo (May 09) 39 by Angelia Teo (May 09) 40 by Angelia Teo (May 09) 41 Nucleic acids are polynucleotides, consist of repeating nucleotide units Each nucleotide contains one phosphate group, one sugar (pentose or deoxypentose) and one base (purine or pyrimidine). Phosphodiester bonds link the 3'-OH of one nucleotide sugar to the 5'-OH group of the adjacent nucleotide sugar. In DNA the sugar is D-2-deoxyribose; in RNA the sugar is D-ribose. RNA has a hydroxyl group on the 2' carbon of the sugar. In DNA the purine bases are adenine (A) and guanine (G), and the pyrimidine bases are thymine (T) and cytosine (C). In RNA, uracil (U) replaces thymine. Chemically modified purine and pyrimidine bases are found in some bacteria and bacteriophages. by Angelia Teo (May 09) 42 DNA is a double-stranded helix; two strands are antiparallel. Double helix is stabilized by H bonds between purine & pyrimidine bases on the opposite strands. A pairs T by 2 H bonds; G pairs C by 3 H bonds. Two strands in DNA helix are complementary, ie. dsDNA contains equimolar amounts of purines (A + G) and pyrimidines (T + C), with A = T and G = C. The mole fraction of G + C in DNA varies widely among different bacteria. DNA is supercoiled and tightly packaged. The extent of sequence homology between DNAs from different microorganisms determines how closely related they are (eg. 16sRNA sequence) RNA exists as a single-stranded molecule; forms hairpin loops (secondary structure) due to intramolecular base-pairing. by Angelia Teo (May 09) 43 DNA Replication in Bacteria The DNA replicates semiconservatively: - Each strand in dsDNA serves as a template for synthesis of a new complementary strand. - Result: daughter dsDNA molecule contains one old polynucleotide strand and one newly synthesized strand. Replication of chromosomal DNA in bacteria starts at a specific chromosomal site called the origin of replication and proceeds bi-directionally until the process is completed. by Angelia Teo (May . 09) Autoradiograph of intact replicating chromosome of E coli. Bacteria were radioactively labeled with tritiated thymidine X Y 44 DNA Replication in Bacteria DNA replication is initiated whenever cells divide, so in rapidly growing bacteria a new round of chromosomal replication begins before an earlier round is completed. The origin regions specifically and transiently associate with the cell membrane after initiation of DNA replication. Membrane attachment directs separation of daughter chromosomes. Time required for replication of the entire chromosome is about 40 minutes (500 – 1000 nucleotides / sec) Replicated chromosomes are partitioned into each of the daughter cells. by Angelia Teo (May 09) 45 by Angelia Teo (May 09) 46 Central Dogma of Molecular Biology How does the sequence of a strand of DNA correspond to the amino acid sequence of a protein? • DNA codes for RNA production. • RNA codes for protein production. • Protein does not code protein, RNA or DNA production. The end. Or in the words of Francis Crick: Once information has passed into protein, it cannot get out again! by Angelia Teo (May 09) 47 Revision of the "Central Dogma" CAN go back from RNA to DNA (reverse transcriptase) RNA can also make copies of itself (RNA polymerase) Still NOT possible from Proteins back to RNA or DNA Not known mechanisms for proteins making copies of themselves. by Angelia Teo (May 09) 48 by Angelia Teo (May 09) 49 Gene Expression Expression of genetic determinants in bacteria involves the unidirectional flow of information from DNA to RNA to protein. Two processes involved are transcription and translation. by Angelia Teo (May 09) 50 Transcription & Translation Prokaryotic vs Eukaryotic cells In a prokaryotic cell, which does not contain a nucleus, this process happens at the same time. In Eukaryotic cells, occur at different cell compartments. by Angelia Teo (May 09) Prokaryotic cell Eukaryotic cell 51 Transcription The DNA-directed synthesis of RNA is called transcription. Transcription produces RNA molecules that are complimentary copies of one strand of DNA. Only one of the dsDNA strands can serve as template for synthesis of a specific mRNA molecule. mRNAs transmit information from DNA, and each mRNA in bacteria function as a template for synthesis of one or more specific proteins. by Angelia Teo (May 09) 52 Translation The process by which the nucleotide sequence of an mRNA molecule determines the primary amino acid sequence of a protein. Ribosomes are complexes of ribosomal RNAs (rRNAs) and several ribosomal proteins. Ribosomes with the aid of transfer RNAs (tRNAs), amino-acyl tRNA synthesases, initiation factors and elongation factors are all involved in translation of each mRNA into corresponding polypeptide (protein). by Angelia Teo (May 09) 53 Translation Initiated at an AUG codon for methionine. Codons are translated sequentially in mRNA from 5' to 3'. The corresponding polypeptide chain / protein is assembled from the amino terminus to carboxy terminus. The sequence of amino acids in the polypeptide is, therefore, co-linear with the sequence of nucleotides in the mRNA and the corresponding gene. by Angelia Teo (May 09) 54 The Genetic code The "universal" genetic code employed by most organisms is a triplet code and it determines how the nucleotides in mRNA specify the amino acids in the polypeptide. • • 61 of 64 possible trinucleotides (codons) encode specific amino acids. 3 remaining codons (UAG, UAA or UGA) code for termination of translation (nonsense codons = do not specify any amino acids) Exceptions: 1) UGA as a tryptophan codon in some species of Mycoplasma and in mitochondrial DNA. 2) Few codon differences in mitochondrial DNAs from yeasts, Drosophila, and mammals. by Angelia Teo (May 09) 55 Gene expression occurs in 2 steps: Transcription of the information encoded in DNA into a molecule of RNA Translation of the information encoded in mRNA into a defined sequence of amino acids in a protein. by Angelia Teo (May 09) 56 The sequence of one strand of DNA is 5’ GGGTAAGCTTATCCCGTA 3’ 3’ CCCATTCGAATAGGGCAT 5’ The sequence of the complementary strand from 5’ to 3’ is A) CCCATTCGAATAGGGCAT B) TACGGGATAAGCTTACCC C) GGGTAAGCTTATCCCGTA D) ATGCCCTATTCGAATGGG by Angelia Teo (May 09) 57 The following is the sense strand of the DNA sequence. Give the amino acid sequence of the protein generated after translation. 3’ TACCCCATGATGGTAGGGTTAGTAGGGTTATCCATGGGG 5’ 5’ ATGGGGTACTACCATCCCAATCATCCCAATAGGTACCCC 3’ TRANSCRIPTION 5’ AUGGGGUACUACCAUCCCAAUCAUCCCAAUAGGUACCCC 3’ TRANSLATION Met Gly Tyr Tyr His Pro Asn His Pro Asn Arg Tyr Pro 5’AUG GGG UAC UAC CAU CCC AAU CAU CCC AAU AGG UAC CCC 3’ by Angelia Teo (May 09) 58 Charlebois, R. 1999. Organization of the Prokaryotic Genome. ASM Press, Washington, D.C. Casjens, S. 1998. The diverse and dynamic structure of bacterial genomes. Ann. Rev. Genet. 32: 339-377. Casjens, S. 1999. Evolution of the linear DNA replicons of the Borrelia spirochetes. Curr. Opin. Microbiol. 2: 529-534. Chen, C. 1996. http://www.ym.edu.tw/ig/cwc/end_troubles/End_Troubles.html Jumas-Bilak et al. 1998. Unconventional genomic organization in the alpha subgroup of the Proteobacteria. J. Bacteriol. 180: 2749-2755. Kobryn K, Chaconas G. 2001. The circle is broken: telomere resolution in linear replicons. Curr Opin Microbiol. 4(5): 558-564. Suwanto, A., and S. Kaplan. 1989. Physical and genetic mapping of the Rhodobacter sphaeroides 2.4.1 genome: presence of two unique circular chromosomes. J. Bacteriol. 171: 5850-5859. Suwanto, A and S. Kaplan. 1992. Chromosome transfer in Rhodobacter sphaeroides: Hfr formation and genetic evidence for two unique circular chromosomes. J. Bacteriol. 174: 11351145. Trucksis et al. 1998. The Vibrio cholerae genome contains two unique circular chromosomes. Proc. Natl. Acad. Sci. USA 95: 14464-14469. Volff, J.-N., and J. Altenbuchner. 2000. A new beginning with new ends: linearisation of circular chromosomes during bacterial evolution. FEMS Microbiol. Lett. 186: 143-150. Yang CC, Huang CH, Li CY, Tsay YG, Lee SC, Chen CW. 2002. The terminal proteins of linear Streptomyces chromosomes and plasmids: a novel class of replication priming proteins. Mol Microbiol. 43(2): 297-305. by Angelia Teo (May 09) 59