* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download “gene we want” into plasmid
Epigenetics in learning and memory wikipedia , lookup
Gene expression programming wikipedia , lookup
Nucleic acid double helix wikipedia , lookup
Gene desert wikipedia , lookup
Metagenomics wikipedia , lookup
Cell-free fetal DNA wikipedia , lookup
Cancer epigenetics wikipedia , lookup
Biology and consumer behaviour wikipedia , lookup
Nucleic acid analogue wikipedia , lookup
Minimal genome wikipedia , lookup
Epigenetics of human development wikipedia , lookup
Gene nomenclature wikipedia , lookup
Epigenetics of diabetes Type 2 wikipedia , lookup
Gene therapy wikipedia , lookup
Non-coding DNA wikipedia , lookup
Gene expression profiling wikipedia , lookup
DNA supercoil wikipedia , lookup
Deoxyribozyme wikipedia , lookup
Genome evolution wikipedia , lookup
Epigenomics wikipedia , lookup
Genome (book) wikipedia , lookup
Point mutation wikipedia , lookup
Nutriepigenomics wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
Genome editing wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
DNA vaccination wikipedia , lookup
Extrachromosomal DNA wikipedia , lookup
Molecular cloning wikipedia , lookup
Genomic library wikipedia , lookup
Therapeutic gene modulation wikipedia , lookup
Designer baby wikipedia , lookup
Helitron (biology) wikipedia , lookup
Site-specific recombinase technology wikipedia , lookup
Genetic engineering wikipedia , lookup
Microevolution wikipedia , lookup
No-SCAR (Scarless Cas9 Assisted Recombineering) Genome Editing wikipedia , lookup
Plasmids Small supplemental circles of DNA 5000 - 20,000 base pairs self-replicating carry extra genes 2-30 genes genes for antibiotic resistance can be exchanged between bacteria Conjugation Transformation transduction AP Biology How can plasmids help us? A way to get genes into bacteria easily insert new gene into plasmid insert plasmid into bacteria = vector bacteria now expresses new gene bacteria make new protein gene from other organism cut DNA plasmid AP Biology recombinant plasmid + vector glue DNA transformed bacteria Biotechnology Plasmids used to insert new genes into bacteria cut DNA gene we want like what? …insulin …HGH …lactase cut plasmid DNA ligase recombinant APplasmid Biology insert “gene we want” into plasmid... “glue” together How do we cut DNA? Restriction enzymes restriction endonucleases discovered in 1960s evolved in bacteria to cut up foreign DNA “restrict” the action of the attacking organism protection against viruses & other bacteria bacteria protect their own DNA by methylation & by not using the base sequences recognized by the enzymes in their own DNA AP Biology Restriction enzymes Action of enzyme Madam I’m Adam racecar cut DNA at specific sequences restriction site symmetrical “palindrome” produces protruding ends CTGAATTCCG GACTTAAGGC sticky ends will bind to any complementary DNA CTG|AATTCCG GACTTAA|GGC Many different enzymes named after organism they are found in EcoRI, HindIII, BamHI, SmaI Sticky ends help glue genes together cut sites gene you want cut sites TTGTAACGAATTCTACGAATGGTTACATCGCCGAATTCACGCTT AACATTGCTTAAGATGCTTACCAATGTAGCGGCTTAAGTGCGAA AATTCTACGAATGGTTACATCGCCG GATGCTTACCAATGTAGCGGCTTAA sticky ends cut sites isolated gene chromosome want to add gene to AATGGTTACTTGTAACG AATTCTACGATCGCCGATTCAACGCTT TTACCAATGAACATTGCTTAA GATGCTAGCGGCTAAGTTGCGAA DNA ligase joins the strands sticky ends stick together Recombinant DNA molecule chromosome with new gene added TAACGAATTCTACGAATGGTTACATCGCCGAATTCTACGATC AP BiologyCATTGCTTAAGATGCTTACCAATGTAGCGGCTTAAGATGCTAGC Copy (& Read) DNA Transformation insert recombinant plasmid into bacteria grow recombinant bacteria in agar cultures bacteria make lots of copies of plasmid “cloning” the plasmid production of many copies of inserted gene production of “new” protein transformed phenotype DNA RNA protein trait AP Biology Grow bacteria…make more gene from other organism recombinant plasmid + transformed bacteria vector plasmid grow bacteria harvest (purify) protein human insulin AP Biology Engineered plasmids Building custom plasmids restriction enzyme sites antibiotic resistance genes as a selectable marker EcoRI BamHI HindIII restriction sites Selectable marker antibiotic resistance gene on plasmid ampicillin resistance selecting for successful transformation successful uptake of recombinant plasmid AP Biology plasmid ori amp resistance Selection for plasmid uptake Antibiotic becomes a selecting agent only bacteria with the plasmid will grow on antibiotic (ampicillin) plate all bacteria grow only transformed bacteria grow a a a a a a LB plate AP Biology a a a a a a a a a a a LB/amp plate cloning Need to screen plasmids Need to make sure bacteria have recombinant plasmid EcoRI BamHI inserted gene of interest restriction sites all in LacZ gene HindIII LacZ gene broken LacZ gene lactose blue color lactose X white color plasmid recombinant plasmid amp resistance origin of AP Biology replication amp resistance Screening for recombinant plasmid Bacteria take up plasmid Functional LacZ gene Bacteria make blue color Bacteria take up recombinant plasmid Non-functional LacZ gene Bacteria stay white color Which colonies do we want? AP Biology