* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download 4.2.08 105 lecture
Proteolysis wikipedia , lookup
Gene nomenclature wikipedia , lookup
Gene therapy wikipedia , lookup
Expression vector wikipedia , lookup
Eukaryotic transcription wikipedia , lookup
RNA polymerase II holoenzyme wikipedia , lookup
Real-time polymerase chain reaction wikipedia , lookup
DNA supercoil wikipedia , lookup
Nucleic acid analogue wikipedia , lookup
Molecular cloning wikipedia , lookup
Transformation (genetics) wikipedia , lookup
Deoxyribozyme wikipedia , lookup
Community fingerprinting wikipedia , lookup
Genetic engineering wikipedia , lookup
Non-coding DNA wikipedia , lookup
Gene regulatory network wikipedia , lookup
Two-hybrid screening wikipedia , lookup
Gene expression wikipedia , lookup
Promoter (genetics) wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
Point mutation wikipedia , lookup
Endogenous retrovirus wikipedia , lookup
Transcriptional regulation wikipedia , lookup
M W M W M W M W M W 3/31 4/2 4/7 4/9 4/14 4/16 4/21 4/23 4/28 4/30 EXAM II Transcription and Translation "Molecular" Genetics "Classical" Genetics Regulation of Gene Expression DNA Replication Genomics and Proteomics EXAM III Molecular Development Molecular Development Chapters 8-12, parts of 2, 3 Chapters 4, 15 Chapter 16 Chapter 13 Chapter 18 Chapter 14 Chapter 20 Chapters 4,13-16,18 Chapter 22 Cumulative Final Exam: Wednesday, May 7th, 10:45-12:45, room 303 Payson-Smith Jabberwocky `Twas brillig, and the slithy toves Did gyre and gimble in the wabe: All mimsy were the borogoves, And the mome raths outgrabe. 1) All living things are composed of cells* 2) All cells come from pre-existing cells* * The Cell Theory 3) All cells exist in a water environment 4) All cells are bounded by a membrane 5) All cells have similar chemistrys (proteins, proteins, proteins) 6) DNA is the primary heritable molecule (DNA’s BIG job is to code for proteins) 7) The concept of gene regulation and totipotency TRANSCRIPTION TRANSLATION The genotype is the plan (blueprint) for creating an organism. For example, your genotype is the entire genetic information you inherited from your mom and your dad. The phenotype is the output / result of using the genotype plan. The whole organism is the “phenotype”, but we typically focus on a specific gene and refer to a specific phenotype for that gene (like the color of your hair color, for example). DNA is the primary heritable molecule for all cells. The genotype is the information stored in the DNA. Genotype information is stored just like words in a book: 1) It is physical – You can point to a word in a book and cut out with a scissors. 2) It is linear – books are organized as a long line of letters that are read one after the other 3) It has letters – there are four letters (nucleotides) in the DNA language: A,G,C, and T 4) It is organized into clusters of information – the line of letters in a book is organized into units of information called words, DNA information is broken up into units of information called genes. 5) Just like a word, a gene has more meaning than just a series of letters. Chapter 4 introduces the chemical structure of DNA and RNA Chapter 15 sort of introduces the concept of the gene. DNA replication is covered in Chapter 14. We’ll talk about it in a couple of weeks. The DNA is also (unzipped, denatured, melted) during gene transcription. Transcription is covered in chapters 16 and 18. We’ll talk about it in a couple of weeks. Symbol 3-letter ------ -------A C D E F G H I K L M N P Q R S T V W Y * Ala Cys Asp Glu Phe Gly His Ile Lys Leu Met Asn Pro Gln Arg Ser Thr Val Trp Tyr STOP Meaning ------- Codons ------ Alanine Cysteine Aspartic Glutamic Phenylalanine Glycine Histidine Isoleucine Lysine Leucine Methionine Asparagine Proline Glutamine Arginine Serine Threonine Valine Tryptophan Tyrosine Terminator GCT,GCC,GCA,GCG TGT,TGC GAT,GAC GAA,GAG TTT,TTC GGT,GGC,GGA,GGG CAT,CAC ATT,ATC,ATA AAA,AAG TTG,TTA,CTT,CTC,CTA,CTG ATG AAT,AAC CCT,CCC,CCA,CCG CAA,CAG CGT,CGC,CGA,CGG,AGA,AGG TCT,TCC,TCA,TCG,AGT,AGC ACT,ACC,ACA,ACG GTT,GTC,GTA,GTG TGG TAT, TAC TAA,TAG,TGA This is what genetic information looks like in a chromosome. ACCAGTGCATCGATCGATTTCGATCGATGCATGCCGCGATCGATGCATGCCGCGCGATCTAGG In this artificial example, there are four “genes” shown but they are hard to spot because we don’t know the language. We can change the letters to our alphabet: ADFTHEBCRDFOURTHNDSFOXLLVSSECONDOPSQUICKIIIFIRSTTOTHESTHIRDXZAPBROWN The genes are organized in a line just like words in a book but the words are still hard to spot because the spaces between words are filled with random letters. ADFTKEBCRDFOURTHNDSFOXLLVSSECONDOPSQUICKIIIFIRSTTPTHESTHIRDXZAPBROWN Also, the words are not in the correct order for the story. The promoter is a part of each gene that tells what order the words are used in the story. The promoter tells where, when, and how much transcription should be done. ADFTHEBCRDFOURTHNDSFOXLLVSSECONDOPSQUICKIIIFIRSTTOTHESTHIRDXZAPBROWN So the words get read out in the proper order: ADFTHEBCRDFOURTHNDSFOXLLVSSECONDOPSQUICKIIIFIRSTTOTHESTHIRDXZAPBROWN THE QUICK BROWN FOX Genes that code for proteins that have related jobs, like the LDL receptor and LDL protein for example, aren’t located next to each other on the chromosome. Their position on the chromosomes doesn’t matter because the promoters control when, where, and how much to make. transcription unit - the part of a gene that gets copied (transcribed) by RNA polymerase coding region – For genes that make (encode) proteins, the coding region is part of the transcription unit. The coding region is the genetic information in the DNA that tells the specific structure (primary amino acid sequence) of the protein to be made. The aquaporin protein has a specific structure due to the primary amino acid sequence and the specific structure of a protein gives each protein a specific function. Again, the coding region provides the information for the primary acid sequence of the protein to be made. promoter – the genetic information in the DNA that tells where, when, and how much the gene should be expressed. You inherited one copy of each of your genes from your mom and one from your dad. The genes from your mom and dad are similar but not identical. 30/60 = 50 +10 = 60 30 is the number of questions you got right. 60 is the total number of questions. 50 is your percentage out of 100 10 is the points you got for your notes (10 points maximum). 60 is your total score and is circled. Compare that with what other students got. 100 98 96 * 94 92 * 90 * 88 *** 86 * 84 * 82 ** 80 ** 78 76 *** 74 ** 72 ** 70 ***** 68 66 ** 64 *** 62 * MEAN = 63 60 *** 58 56 54 ** 52 * 50 ** 48 * 46 * 44 ***** 42 *** 40 * 38 36 ** 100 98 96 * 94 92 * 90 * 88 *** 86 * 84 * 82 ** 80 ** 78 76 *** 74 ** 72 ** 70 ***** 68 66 ** 64 *** 62 * 60 *** 58 56 54 ** 52 * 50 ** 48 * 46 * 44 ***** 42 *** 40 * 38 36 ** A _____ A_____ B+ _____ B _____ C+ _____ C _____ C_____ D+ _____ D _____ D_____ F MEAN = 63