* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download PowerPoint 演示文稿
List of types of proteins wikipedia , lookup
Bottromycin wikipedia , lookup
Genome evolution wikipedia , lookup
X-inactivation wikipedia , lookup
Molecular evolution wikipedia , lookup
Transcription factor wikipedia , lookup
Alternative splicing wikipedia , lookup
Gene regulatory network wikipedia , lookup
Genetic code wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
Non-coding DNA wikipedia , lookup
Biosynthesis wikipedia , lookup
RNA interference wikipedia , lookup
Nucleic acid analogue wikipedia , lookup
Messenger RNA wikipedia , lookup
Deoxyribozyme wikipedia , lookup
Promoter (genetics) wikipedia , lookup
Polyadenylation wikipedia , lookup
RNA silencing wikipedia , lookup
Silencer (genetics) wikipedia , lookup
Gene expression wikipedia , lookup
RNA polymerase II holoenzyme wikipedia , lookup
Eukaryotic transcription wikipedia , lookup
Epitranscriptome wikipedia , lookup
Chapter 16 Transcription and Posttranscriptional Processing The term transcription in molecular biology means RNA biosynthesis. In 1955 Francis Crick hypothesized that there were intermediate molecules which participated in transferring genetic information from DNA to protein. The intermediate molecule was RNA. In 1958 he put forth the famous central dogma. --- -- DNA-------- RNA------ protein -------Temin 1970 In 1961 the DNA dependent RNA polymerase was discovered in E coli and the study on the mechanism of transcription began. In 1982 Thomas Cech discovered that one of the precursor RNA in Tetrahymena chould act as a catalyst and catalyzed self-splicing. It is a ribozyme. Section 1 DNA dependent RNA synthesis RNA synthesis is catalyzed by DDRP ( or simply RNA polymerase. ) Characteristics of RNA synthesis Template DNA ( one strand DNA in dsDNA, template strand ) Substrate four kinds of NTP Enzyme DDRP ( no reqirement of primer, no proof-reading function ) Direction of RNA chain synthesis 5’ to 3’ Base pairing rule GC TA AU Inorganic ion Mg++ Zn++ The process of transcription can be divided into three stages: initiation, elongation and termination. see the fig. on the blackboard The two strands in dsDNA are complementary. They are the coding strand and the template strand. The template strand works as the template for the synthesis of RNA. The synthesized RNA is complementary to the template strand. Its sequence is the same as that of the coding strand with the exception of the substitution of U for T. eg. 5’ CGCATTAACG 3’ coding strand 3’ GCGTAATTGC 5’ template strand 5’ CGCAUUAACG 3’ RNA transcript The Reaction ( NMP )n + NTP ---------- ( NMP )n+1 +PPi Asymmetric Transcription --------------- ---------------- ________________________________________________ ________________________________________________ ---------- ----------- In dsDNA one strand is coding strand. It is not transcribed. The other strand is template strand. It is transcribed. In a segment of dsDNA the coding information of genes may be in different strands. RNA polymerase There is only one type of RNA pol in prokaryotes while there are three types of RNA pols in eukaryotes. E coli RNA polymerase E coli RNA pol catalyzes synthesis of all the RNAs ( mRNA , rRNA , tRNA etc ) Structure of E coli RNA polymerase The holoenzyme of E coli RNA pol contains α2ββ’(ω)σ subunits The σ subunit can be dissociated from the holoenzyme. The RNA pol without σ subunit is called core enzyme: α2ββ’(ω) Function of the Subunit σ can recognize promoters and initiate transcription. α can bind regulatory proteins and control the transcriptional rate. β+β’ catalyzes RNA synthesis. There may be ω subunit. Its function is unknown. There are different kinds of σ subunits. The most common one is σ70. . Eukaryotic RNA polymerases RNA pol I RNA pol II RNA pol III ____________________________________________________ Product 45SrRNA hnRNA tRNA synthesized ( precursor ( precursor 5SrRNA precursors of 18S, 28S of mRNA) snRNA 5.8S rRNAs) ____________________________________________________ Sensitivity to no high intermediate α-amanite ____________________________________________________ Structure of Eukaryotic RNA pols Each type of eukaryotic RNA pols contains two different large subunits and ten odd small subunits. The largest subunit of RNA pol II contains consensus sequence at the carboxyl terminal called CTD. CTD is composed of several dozens of heptad ( YSPTSPS ) repeats. CTD Function RNA pol II with the unphosphorylated CTD participates in the beginning of transcriptional initiation. During the process of intiation many Ser and some Tyr residues of CTD are phosphorylated. RNA pol II with the phosphorylated CTD fulfills the initiation and leaves the promoter. RNA synthesis enters in the stage of elongation. Prokaryotic Transcriptional Initiation Prokaryotic RNA pol binds the promoter and initiates transcription. Promoter : DNA sequence that is usually upstream of a gene’s coding sequence and that RNA pol binds and initiates transcription. σ subunit can recognize the promoter E coli promoters extend from –70 to +30 of the initiation site (+1) Most of them have two regions of consensus sequence , the -35 region ( TTGACA ) and the -10 region ( Pribnow box TATAAT ). σ70 can recognize the consensus sequence. Some promoters of genes with high transcriptional rate have another consensus region , the AT-rich up-element (-40 to -60 ) which α subunit binds. The holoenzyme of RNA pol binds the promoter via σ subunit. strong promoter / weak promoter It is the -35 and -10 regions and the distance between them and the distance between –10 region and the transcriptionnal initiation site , that determines the transcriptional rate. The more similar the –35 and –10 regions of a promoter to the consensus sequences of TTGACA and TATAAT , the stronger affinity it has for RNA pol binding. That results in the higher transcriptional rate. And vice versa. Process of Prokaryotic Trancriptional Initiation RNA pol recognizes and binds the promoter. That forms a close transcription complex. DNA double helix near –10 region unwinds. That results in an open transcription complex. Transcription begins. A triple-element complex of DNA, RNA pol and the newly synthesized RNA forms The formation of the triple-element complex causes conformation change. RNA pol leaves the promoter and elongation begins. As the elongation begins the σ subunit dissociates from RNA pol. It is the core enzyme of RNA pol that is responsible for the elongation. Eukaryotic Transcriptional Initiation Eukaryotic RNA pols alone can not initiate transcription. Only with the help of transcription factors can they fulfill the task of initiation. Transcriptional initiation of RNA pol II needs not only the enzyme but also multiple transcription factors. There are consensus sequences in many of the RNA pol II recognized promoters. They are –30 region ( TATA box ) and +1 region ( the initiation site , initiator , Inr ). The initiation stage of RNA pol II can be divided into two steps : the assembly step and the initiation step. The Assembly Step TBP ( TATA-binding protein ) binds TATA box. TFIIB ( or with TFIIA ) binds TBP and promoter. With the help of TFIIF , RNA pol II- TFIIF complex interactes with TFIIB and binds TFIIB and promoter. Then TFIIE and TFIIH join them. RNA pol II and the TFII factors form a close initiation complex on the promoter. The Initiation Step TFIIH has both the helicase and the kinase activities. It unwinds dsDNA. The close initiation complex becomes the open initiation complex. TFIIH also catalyzes phosphorylation of CTD. RNA pol II with phosphorylated CTD initiates transcription. The Initiation Stage of RNA pol I or RNA pol III The initiation stage of RNA pol I or RNA pol III is similar to that of RNA pol II. The transcription factors recognize and bind the promoter. RNA pol I or RNA pol III joins them to form an initiation complex. Initiation begins. Initiation Stage of RNA pol I rDNA ( contains genes of 18 S rRNA, 28 S rRNA and 5.8 S rRNA ) is transcribed by RNA pol I. The product is 45SrRNA There are two consensus sequences in rDNA promoter : core element ( +1 region ) and UCE ( upstream control element ). Transcription factor UBF binds UCE first. Then transcription factor SL1 binds core element. RNA pol I joins them. They form a complex on promoter. Initiation begins. RNA pol III initiates transcription of 5SrRNA gene or tRNA gene. There are internal promoters in such genes. Internal promoter means the promoter within the coding region of the gene. tRNA gene’s promoter has two consensus sequences : A box and B box, while 5SrRNA gene’s promoter has only one consensus sequence : C box. Transcriptional Initiation of 5SrRNA Gene TFIIIA binds C box. TFIIIC and TFIIIB bind TFIIIA. RNA pol III binds them. A complex is formed. RNA pol III initiates transcription. Initiation RNA pol I RNA pol III RNA pol II __________________________________________________ ATP requirement no no yes __________________________________________________ A and B or TATA box core consensus sq. core element C box Inr __________________________________________________ CAAT box upstream element UCE GC box etc __________________________________________________ general TFs SL1 TFIIIA B C various TFIIs ___________________________________________________ upstream factors UBF various upstream factors _____________________________________________________ Transcriptional Termination There are two types of transcriptional termination in prokaryotes ρ independent and ρ dependent. ρ independent termination There are two characteristics of ρ independent termination sq. ( terminator ). A segment of GC-rich , self-complementary sq. It is followed by a series of T. eg GCCGCCAGTTCGGCTTGCCGCCTTTT The RNA synthesized is also self-complementary and forms a stem-loop structure followed by aseries of U. UU 5’ GCCGCCAG C CGGCGGUC U U GG U U U 3’ RNA pol interacts with the structure and stops at the template The UA pairs are unstable. The newly synthesized RNA releases from the template. Transcription terminates. ρ dependent termination The terminator of the ρ dependent termination is not typical. It contains CA-rich region which ρ factor can recognize. ρ factor is a homo-hexamer protein factor , can bind the newly synthesized RNA and moves to the RNA-DNA hybrid region. ρ factor has helicase activity and unwinds the RNA-DNA helix depending on the energy released from ATP hydrolysis. Section 2 Posttranscriptional Processing Mature eukaryotic mRNA has experienced 5’- and 3’ end processing and splicing. hnRNA ( or mRNA ) is capped at 5’ end Most hnRNA have a cap of 7-methylguanosine triphosphate ( m7Gppp-) at the 5’ end. It is added to the 5’ end of the growing transcript of 25-30 nucleotides via 5’5’ triphosphate linkage. The cap protects hnRNA ( and mRNA ) from Rnase attack and participates in the binding of mRNA and ribosome. hnRNA ( or mRNA ) has a poly A tail at the 3’end Almost all of eukaryotic hnRNAs ( or mRNAs ) have a poly A tail of 80-250 nucleotides at the 3’end. It is enzymatically added to the primary transcript intwo stages. Cleavage The transcript is cleaved 10 to 30 nucleotides past a highly conserved AAUAAA sq ( the polyadenylation signal sq ) and within 50 nucleotides before a GU-rich sq. 10-30nts < 50nts -----------AAUAAA----------------I-------------------GU-rich— cleavage site Polyadenylation The poly A tail is subsequently generated from ATP through stepwise action of poly A polymerase. Multiple enzymes and protein factors participate in the two stages. Splicing. Split Gene , Exon and Intron Eukaryotic genes consist of alternating coding and noncoding sequences. In other words the coding sq of eukaryotic genes is not continuous. They are split genes. The coding sq in the split gene is called the exon, the non-coding sq, the intron. hnRNA is co-linear to its template DNA except the cap and the tail. It also contains alternating exons and introns. The coding sq of mRNA is continuous. hnRNA following excision of introns and connection of exons becomes mRNA. This process is called splicing. The Mechanism of Splicing There are consensus sequences at the junctions of exon and intron . They are called splice sites. The shortest splice sites at the 5’ end ( splice donor ) and 3’ end ( splice acceptor ) of the intron are GU and AG respectively. Upstream of AG there is a branch point A . exon 1 intron exon 2 ========GU-----------------------A-----AG============= splice donor branch point splice acceptor The branch point A initiates nucleophilic attack at the 5’end of the intron. It is the first transesterification reaction. -----------------=========GU-----------------A-------AG============= Exon1 is released. Intron forms a lariat. -----G ==========OH -----A------AG============= The 3’end of exon 1 initiates nucleophilic attack at the 3’ end of the intron. It is the second transesterification reaction. ===========OH > G -----A------AG============= Exon1 and exon2 are connected. Lariat form of intron is released. Splicing is completed. ============ ================= G -----A------AG The previously described splicing takes place in the spliceosome. Spliceosome contains snRNPs which are composed of snRNAs and proteins. snRNAs in snRNPs are U-rich, and called URNAs. There are 5 URNAs. .The process of splicing in the spliceosome includes spliceosome assembly, spliceosome activation and splicing An eukaryotic gene may direct transcription of different hnRNAs from different promoters or using different polyadenylation sites. There are two promoters in glucokinase gene. In the liver cell transcription initiates from the second promoter which is near the coding sq, while in the pancreatic β cell transcription initiates from the first promoter which is upstream located. This is an example that one gene can express different hnRNAs ( and mRNAs ). In the different developmental stages of lymphocyte B 3’ end processing of the hnRNA of μ chain can use different polyadenylation sites and yield different hnRNAS ( and mRNA ) This is another example. Alternative Splicing Provides for Different mRNAs from the Same hnRNA The mechanism of alternative splicing includes the selective inclusion or exclusion of exons, the use of alternative 5’donor or 3’ acceptor sites. exon1 exon2 exon3 ========-----------=====-------=============hnRNA splicing1 (mRNA1) exon1 exon2 ======== ===== splicing2 (mRNA2) exon2 exon3 ===== ============= splicing3 (mRNA3) exson1 exon2 exon3 ======== ===== ============== hnRNA ===========-------======------------=============== 2 donor sites in exon1 2 acceptor sites in exon3 3mRNAs =========== ====== ============== exon 1+2+3 ====== ====== ============== part of exon 1+e2+e3 =========== ====== ====== e1+e2+ part of exon 3 rRNA precursor processing requires Rnases prokaryotic 30SrRNA precursor---- methylation ---- Rnases cut ---- precursors of 23SrRNA, 16SrRNA 5SrRNA and tRNA---- Rnases cut ---- 23SrRNA 16SrRNA , 5SrRNA and tRNA eukaryotic 45SrRNA precursor----methylation -----snoRNP mediated processing----precursors of 18SrRNA , 28SrRNA , 5.8SrRNA ----snoRNP mediated processing ---- 18SrRNA , 28SrRNA , 5.8SrRNA tRNA precursor processing tRNA precursor processing in prokaryotes and eukaryotes are similar. It includes 5’end cutting 3’end cutting and CCA adding (if there isn’t CCA) splicing (if there is intron , splicing takes place via enzymatic cutting and joining) base modification. Self-splicing Catalyzed by RNA In 1982 T. Cech discovered that the intronof Tetrahymena rRNA precursor could catalyzed self-splicing. The intron that can catalyze self-splicing belongs to the group I intron. Group I intron catalyzes self-splicing with the help of cofactor guanosine or guanosine phosphate The self-splicing includes two transesterfication reactions 5’=============---------------------==============3’ exon 1 exon 2 5’=============----------------------==============3’ G-OH G-OH attacks the first nucleotide at the 5’end of the intron. Exon 1 is released. 5’=============OH G--------------------============3’ Exon 1’s 3’end attacks the nucleotide at the 3’ end of the intron. G----------------=================3’ 5’==============OH Two exons are connected. The intron is released. 5’============== ==================3’ G---------------OH There are group II introns , which can also catalyze selfsplicing. They catalyze self-splicing just like the previously mentioned lariat-form splicing. It also includes two transesterification reactions but does not take place in spliceosome and does not require any cofactor. Group I and group II introns are ribozymes. Some mRNAs Undergo Editing Coding information can be changed at the mRNA level by RNA editing. In such cases the coding sq of the mRNA differs from that in the cognat DNA. RNA editing is discovered first in protozoan and mediated by g-RNA. Some nucleotides can be changed in or added into or deleted from the mRNA coding sq by RNA editing. That results in change of the genetic codon and / or the reading frame of the coding sq. The expressed protein is changed. An example of human RNA editing is the apolipoprotein B mRNA. In liver the single apoB gene is transcribed into an mRNA that directs the synthesis of a 100 Kda protein . In the intestine the same gene directs the synthesis of the primary transcript however acytidine deamination converts a CAA codon in the mRNA to UAA at a single specific site. Rather than encoding glutamine this codon becomes stop codon and a 48 Kda protein is the result. Section 3 RNA dependent RNA synthesis RNA as genetic material All plant viruses, several bacteriophages and many animal viruses have genomes consisting of RNA. There are three types of RNA genomes : dsRNA, ssRNA and two copies of the same ssRNA. The dsRNA and ssRNA are replicated by RNA replicase ( RNA dependent RNA polymerase, RDRP ). In most cases RNA genome is single stranded. There are two subtypes of ssRNA genomes the +ssRNA and the –ssRNA. +ssRNA genome functions both as genetic material and mRNA, while –ssRNA genome serves only as genetic material. Viruses with ssRNA genomes use the ssRNA as a template for the synthesis of a complement strand , which can then serve as template in replicating the original strand. Retroviruses have two copies of the same ssRNA as the genome. They carry the reverse transcriptase. It has three enzymatic activities : RDDP , DDDP and Rnase H
 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
                                             
                                             
                                             
                                             
                                             
                                             
                                             
                                             
                                             
                                             
                                            