* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download No Slide Title
Saethre–Chotzen syndrome wikipedia , lookup
Genomic imprinting wikipedia , lookup
Polycomb Group Proteins and Cancer wikipedia , lookup
Biology and consumer behaviour wikipedia , lookup
Point mutation wikipedia , lookup
Epigenetics of neurodegenerative diseases wikipedia , lookup
Pathogenomics wikipedia , lookup
Genome evolution wikipedia , lookup
Quantitative trait locus wikipedia , lookup
Neuronal ceroid lipofuscinosis wikipedia , lookup
Gene desert wikipedia , lookup
Epigenetics of diabetes Type 2 wikipedia , lookup
Gene therapy wikipedia , lookup
Epigenetics of human development wikipedia , lookup
Gene therapy of the human retina wikipedia , lookup
Public health genomics wikipedia , lookup
Gene nomenclature wikipedia , lookup
Nutriepigenomics wikipedia , lookup
Gene expression programming wikipedia , lookup
Genome (book) wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
Genetic engineering wikipedia , lookup
Gene expression profiling wikipedia , lookup
Site-specific recombinase technology wikipedia , lookup
Therapeutic gene modulation wikipedia , lookup
Genetically modified crops wikipedia , lookup
Helitron (biology) wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
Microevolution wikipedia , lookup
Gene Regulation Gene regulation and expression in plants- overview Plant development and the environment Signal transduction- a general view Regulation of plant genes and transcription factors Light regulation in plants and Phytochrome Light regulated elements Plant growth regulators Abscisic acid (ABA) and ABA-responsive genes Gene Regulation Regulation of gene expression in plants is essentially the same as in animals. But, the hormones (plant growth regulators) in plants are very different. Also, plant development is profoundly influenced by environment. Therefore, this lecture deals with gene regulation in response to 1/ light, 2/ plant growth regulators using absisic acid as an example Plants and gene expression Plants undergo chronological changes in morphology and therefore require developmentally regulated gene expression. Plants have organs (not so many as higher animals) and therefore require organ specific gene expression. Plants cannot move their entire body and must therefore respond to changes in the environment. They therefore require environmentally regulated gene expression. Plant Development and the Environment ENVIRONMENTAL STIMULI Light- intensity, direction, duration Gravity Touch Temperature Water Pathogen infection RESPONSES TO THE ENVIRONMENT Nastic Responses Tropic Responses Morphogenic Responses Localised Cellular Responses Systemic Cellular Responses COMPONENTS OF ENVIROMENTALLY REGULATED BEHAVOIUR Perception Signal Transduction Response Plant Development and the Environment Nastic Responses- (greek nastos = ‘pressed closed’) typically a non-growth response that is not orientated with regard to the stimulus e.g. closing flower at night, stomatal closure. Tropic Responses- (greek trope = ‘turn’)typically a growth response that is orientated with regard to the stimulus e.g. gravitropism, phototropism. Morphogenic Responses- a response which results in fundamental change in plant metabolism or form e.g. photomorphogenesis. Localised Cellular Responses- small scale changes in cell metabolism e.g. hypersensitive response to pathogens. Systemic Cellular Responses- whole plant changes in cell metabolism e.g. systematic acquired resistance Signal Transduction Components Stimulus Hormones, physical environment, pathogens Receptor On the plasmamembrane, or internal Secondary messengers Ca2+, G-proteins, Inositol Phosphate Effector molecules Protein kinases or phosphatases Transcription factors Response Stomatal closure Change in growth direction Signal transduction Simplified model STIMULUS Ca2+ Plasma membrane R Ca2+ Phos Kin Nuclear membrane R TF DNA Regulation of a Plant Gene Polyadenylation signal Distal elements CAAT/AGGA box TATA box and enhancers TCS (transcription Stop codon TAA,TAG,TGA start site ATG) I -1000 -74 bp -54 to -50bp to -16 bp I Promoter Transcribed untranslated regions Coding sequence (exons) I Introns Regulation of transcription: Transcription factors Bind to RNA polymerase and effect the rate of transcription TATA box Coding region Transcription initiation RNA Polymerase Transcription factors Light in Plants We see visible light (350-700 nm) Plants sense Ultra violet (280) to Infrared (800) Examples Seed germination - inhibited by light Stem elongation- inhibited by light Shade avoidance- mediated by far-red light There are probably 4 photoreceptors in plants We will deal with the best understood; PHYTOCHROMES The structure of Phytochrome A dimer of a 1200 amino acid protein with several domains and 2 molecules of a chromophore. Chromophore 660 nm 730 nm Pr Pfr Binds to membrane Signal Transduction of Phytochrome Membrane Pfr Ga G protein a subunit Pr Guanylate cyclase cGMP Ca2+/CaM Calmodulin CAB, PS II ATPase Rubisco FNR PS I Cyt b/f Chloroplast biogenesis CHS Cyclic guanidine monophosphate bZIP Myb ? Anthocyanin synthesis Light-Regulated Elements (LREs) e.g. the promotor of chalcone synthase-first enzyme in anthocyanin synthesis Promoter has 4 sequence motifs which participate in light regulation. If unit 1 is placed upstream of any transgene, it becomes light regulated. -252 -230 IV III -159 II -131 +1 I Unit 1 5’-CCTTATTCCACGTGGCCATCCGGTGGTGGCCGTCCCTCCAACCTAACCTCCCTTG-3’ Transcription Factors bZIP Myb Light-Regulated Elements (LREs) There are at least 100 light responsive genes (e.g. photosynthesis) There are many cis-acting, light responsive regulatory elements 7 or 8 types have been identified of which the two for CHS are examples No light regulated gene has just 1. Different elements in different combinations and contexts control the level of transcription Trans-acting elements and post-transcriptional modifications are also involved. Plant growth regulators and their impact on plant development Hormone Response (not a complete list) Auxin Abscission suppression; apical dominance; cell elongation; fruit ripening; tropism; xylem differentiation Cytokinin Bud activation; cell division; fruit and embryo development; prevents leaf senescence Gibberellin Stem elongation; pollen tube growth; dormancy breaking Abscisic Acid Initiation of dormancy; response to stress; stomatal closure Ethylene Fruit ripening and abscission; initiation of root hairs; wounding responses Abscisic Acid (ABA) responsive genes ABA is involved in two distinct processes 1/ Control of seed development and germination 2/ Stress responses of the mature plant DROUGHT IN SALINITY A suite of stress response genes are turned on COLD The signal transduction pathway is still poorly understood but certain common regulatory elements have been found in the promoters of ABA responsive genes. CH3 CH3 CH3 OH O CH3 COOH Promoter studies of ABA responsive elements in Barley Section of the upstream region of a barley ABA responsive gene CCGGCTGCCCGCCACGTACACGCCAAGCACCCGGTGCCATTGCCACCGG -104 -56 (Shen and Ho 1997) Minimal promoter Reporter gene (GUS) ABA responsiveness GUS activity in the presence of ABA related to no ABA 1x 38x 24x 55x 87x ABA responsive elements GCCACGTACANNNNNNNNNNNNNNNNNNNNTGCCACCGG-------- ACGCGTCCTCCCTACGTGGC----------------------------------- Plant Disease Resistance Importance of pests and pathogens Complete v.s. partial resistance Gene for gene theory Cloned resistance genes A model of Xa21, blight resistance gene The arms race explained Where does our food go? The proportion of total production lost due to biotic constraints 1967 1988-90 Weeds 10% Weeds 13% Pests 11% Product 67% Pathogens 12% Product 58% Pests 16% Pathogens 13% We are engaged in a continuous struggle to control weeds, pests and diseases Some important pest and pathogens of plants Pathogens Fungi Bacteria Viruses Specific molecular defense mechanisms Pests Nematodes Insects Vertebrates (not fish!) Complete and Partial Resistance There are two fundamentally different mechanisms of disease resistance. Complete resistance Partial Resistance vertical resistance Highly specific (race specific) Involves evolutionary genetic interaction (arms race) between host and one species of pathogen. QUALITATIVE horizontal resistance Not specific- confers resistance to a range of pathogens QUANTITATIVE Complete and Partial Resistance There are two fundamentally different mechanisms of disease resistance. Complete resistance Partial resistance Frequency % Frequency % 40 30 25 30 20 20 15 10 10 5 0 0 1 2 3 4 5 6 7 8 Disease severity class 9 10 1 2 3 4 5 6 7 8 Disease severity class 9 10 Gene-for-Gene theory of Complete Resistance Pathogen has virulence (a) and avirulence (A) genes A a Plant has resistance gene RR rr If the pathogen has an Avirulence gene and the host a Resistance gene, then there is no infection Gene-for-Gene theory of Complete Resistance The Avirulence gene codes for an Elicitor molecule or protein controlling the synthesis of an elicitor. The Resistance gene codes for a receptor molecule which ‘recognises’ the Elicitor. A plant with the Resistance gene can detect the pathogen with the Avirulence gene. Once the pathogen has been detected, the plant responds to destroy the pathogen. Both the Resistance gene and the Avirulence gene are dominant Gene-for-Gene theory of Complete Resistance What is an elicitor? It is a molecule which induces any plant defence response. It can be a polypeptide coded for by the pathogen avirulence gene, a cell wall breakdown product or low-molecular weight metabolites. Not all elicitors are associated with gene-for-gene interactions. What do the Avirulence genes (avr genes) code for? They are very diverse! In bacteria, they seem to code for cytoplasmic enzymes involved in the synthesis of secreted elicitor. In fungi, some code for secreted proteins, some for fungal toxins. ELICITORS Elicitors are proteins made by the pathogen avirulence genes, or the products of those proteins Elicitors of Viruses Coat proteins, replicases, transport proteins Elicitors of Bacteria 40 cloned, 18-100 kDa in size Elicitors of Fungi Several now cloned- diverse and many unknown function Elicitors of Nematodes Unknown number and function Gene-for-Gene theory of Complete Resistance What does a resistance gene code for? The receptor for the specific elicitor associated with the interacting avr gene Protein structure of cloned resistance genes N C Pto tomato; bacterial resistance N C Xa21 rice; bacterial resistance N C Hs1 sugar beet; nematode res. Cf9, Cf2 tomato; fungal resistance N C L6 flax; fungal resistance C RPS2, RMP1 Arabidopsis; bac. res. N tomato; viral resistance Prf tomato; bacterial resitance N Membrane anchor site Transmembrane domain Serine/threonine protein kinase domain Conserved motif Signal peptide Leucine zipper domain Leucine-rich repeat DNA binding site Model for the action of Xa21 (rice blight resistance gene) Leucine-rich receptor Transmembrane domain Elicitor Cell Wall Membrane Kinase Signal transduction ([Ca2+], gene expression) Plant Cell The arms race explained An avirulence genes mutates so that it’s product is no longer recognised by the host resistance gene. The host resistance gene mutates to a version which can detect the elicitor produced by the new virulence gene. It therefore becomes a virulence gene relative to the host, and the pathogen can infect. Hypersensitive Reaction/ Programmed Cell Death In response to signals, evidence suggests that infected cells produce large quantities of extracellular superoxide and hydrogen peroxide which may 1. damage the pathogen 2. strengthen the cell walls Oxidative 3. trigger/cause host cell death Burst Evidence is accumulating that host cell also undergo changes in gene expression which lead to cell death Programmed Cell Death Systemic Acquired Resistance Inducer inoculation 3 days to months, then inoculate SAR- long-term resistance to a range of pathogens throughout plant caused by inoculation with inducer inoculum Local acquired resistance Systemic acquired resistance Similarity with animals 1. Resistance/avirulence gene interaction is analogous to animal antibodies- involves protein-protein binding is highly specific 2. Oxidative burst is analogous to neutrophil action 3. Programmed cell death is common to both plants and animals 4. Systemic acquired resistance is like immunity Marker Assisted Selection Targets for crop improvements Genetics of improvement Molecular mapping Mapping a qualitative trait Marker assisted selection for aroma in rice Marker assisted selection for multiple resistant genes Mapping quantitative traits QTLs and marker assisted selection Targets for Improvement Targets for improvement in rice production fall into three categories Biotic constraints- (pests and diseases) Weeds, Fungi (e.g. Blast), Bacteria (e.g. Blight), Viruses (e.g. Rice yellow mottle virus), Insects (e.g. Brown plant hopper), Nematodes (e.g. Cyst-knot nematode) Abiotic constraints (adverse physical environment) Drought, Nutrient availability, Salinity Cold, Flooding Yield and quality Plant morphology, Photosynthetic efficiency, Nitrogen fixation, Carbon partitioning, Aroma Genetics of improvement Biotic constraintsQualitative (complete resistance) Quantitative (partial resistance) Abiotic constraintsQuantitative (mostly) Yield and qualityQualitative (aroma, partitioning) Quantitative (morphology, partitioning) Requires genetic engineering (photosynthesis, n. fixation) Marker Assisted Selection Useful when the gene(s) of interest is difficult to select for. 1. Recessive Genes 2. Multiple Genes for Disease Resistance 3. Quantitative traits 4. Large genotype x environment interaction Molecular Maps Molecular markers (especially RFLPs and SSRs) can be used to produce genetic maps because they represent an almost unlimited number of alleles that can be followed in progeny of crosses. Chromosomes with morphological marker alleles Chromosomes with molecular marker alleles RFLP1b RFLP2b SSR1b T t r R or RFLP1a RFLP2a SSR1a RFLP3b RFLP3a SSR2b SSR2a RFLP4b RFLP4a 1 2 3 4 5 6 51 cM 54 cM 54 cM 51 cM 7 8 9 10 11 12 48 cM Molecular map of cross between rice varieties Azucena and Bala. Mapping population is an F6 MOLECULAR MAPS CAN BE USED TO LOCATE GENES FOR USEFUL TRAITS (CHARACTERISTICS) To locate useful genes on chromosomes by linkage mapping, you need 1. A large mapping population (100 + individuals) derived from parental lines which differ in the characteristic or trait you are interested in. 2. Genotype the members of the population using molecular markers which are polymorphic between the parents (e.g. RFLPs, AFLPs, RAPDs) 3. Phenotype the members of the population for the trait making sure you asses each individual as accurately as possible Bala F1 (self) 1 Individual F2 F2 F2 F2 F2 (self) 205 individuals F3 F3 F3 F3 F3 (self) 205 individuals F4 F4 F4 F4 F4 (self) 205 individuals F5 F5 F5 F5 F5 (self) 205 individuals Single Seed Decent Azucena x Seed multiplication F6 F6 F6 F6 F6 205 families What is an F6 mapping population? Making A Linkage Map R642 RZ141 G320 G44 RG2 C189 G1465 Rice chromosome 11 Genotype G320 RG2 C189 A A A A A B A B A A B B B A A B B A B A B B B B Total No. of Individuals 47 8 5 15 19 24 3 42 . 163 Recombinants between G320 and RG2 = 5 + 15 + 19 + 3 = 42 = 26% Recombinants between RG2 and C189 = 8 + 5 + 24 + 3 = 40 = 25% Recombinants between G320 and C189 = 8 + 15 + 19 + 24 = 66 = 40% Making a Linkage Map A A A G320 RG2 C189 A A A B B A Frequency of Genotype B B A 47 8 5 15 19 24 3 42 Mapping a Qualitative Trait e.g. disease resistance For a complete resistance gene, one parent is resistant, the other is susceptible The individuals in the segregating population are either resistant or susceptible. Segregation of disease resistance in population % of Individuals 60 50 40 30 20 10 0 0 1 2 3 4 5 6 7 Disease Severity Class 8 9 % of Individuals Not Infected Disease resistant individuals for each genotype 0% 0% 80% 87% 37% 100% 0% 100% Mapping a Qualitative Trait 11 R642 RZ141 G320 G44 RG2 100 C189 80 60 A B 40 20 G1465 Blast resistance gene 0 Parents G320 RG2 Genotype at RFLP C189 Marker Assisted Selection for Aroma in Rice The variety Azucena is aromatic (i.e. it smells pleasant and it’s seeds smell and taste pleasant) Therefore Azucena rice fetches a higher price The aroma gene is recessive. Therefore, it can’t be followed in backcross breeding. The gene for aroma has been mapped to chromosome 8 Kalinga III is a popular variety in Eastern India but it is not aromatic. The aroma gene of Azucena has been crossed into Kalinga III by selection for RFLPs linked to the aroma gene Azucena Kalinga III F1 Selected BC1 Non-selected BC1 Azucena Kalinga III F1 Selected BC1 Non-selected BC1 Marker Assisted Selection Using molecular markers as selection criteria rather than the gene you want to transfer Chromosome 8 G1073 R2676 Aroma gene flanked by G1073 and R2676 Marker Assisted Selection in Disease Resistance Resistance genes can be selected for by screening with the disease. So, conventional breeding can produce resistant varieties. But, resistance genes break-down. The disease organism mutates to overcome them (in 2-3 years). If there were several resistance genes, the disease organism would take very much longer to overcome all resistance genes (in fact it is virtually impossible). But, you can’t select for say 3 resistance genes conventionally- you can’t tell the difference between 1 gene and 2 or 3 by phenotype. But if you select for markers linked to the resistance genes, you can introduce multiple resistance genes. Marker Assisted Selection in Disease Resistance Donor1 Donor 2 Donor 3 Selectable markers Elite variety Multiple crosses followed by backcrossing with selection for markers at every stage Elite variety with multiple resistance genes Mapping a Quantitative Trait e.g. rooting depth 11 30 10 0 R642 RZ141 G320 20 200 250 300 350 400 450 500 550 600 650 Max. Root Length Class (mm) G44 RG2 Max. Root Length (mm) % of Individuals 40 C189 600 550 500 450 400 350 300 A G1465 B Parents G320 RG2 Genotype at RFLP C189 Root length gene Mapping a Quantitative Trait e.g. rooting depth 30 20 Difference between parents is 360 mm 10 0 Max. Root Length (mm) % of Individuals 40 200 250 300 350 400 450 500 550 600 650 Max. Root Length Class (mm) 600 550 500 450 400 350 300 Difference between genotype classes at RG2 is 50 mm A B Parents G320 RG2 Genotype at RFLP C189 This locus accounts for 16% of the difference Quantitative trait loci (QTLs) and Marker Assisted Selection QTLs (the location of a gene contributing to a quantitatively variable trait) are difficult to select for conventionally; it is very difficult to identify individuals with the QTL from those without because its effect is small. Marker assisted selection can be used once markers at the QTL have been found. Multiple QTLs can be combined for greater effect. 1 2 3 4 5 6 51 cM 54 cM 54 cM 51 cM 7 8 9 10 11 12 48 cM Azucena QTLs targeted in the Marker Assisted Selection to improve the root system of Kallinga III Genetic Engineering Genetic transformations Agrobacterium transformations Direct transfer methods for transformation Transformation cassettes From transformed cells to plants The use of transformed plants in research Mutants Transposon Transposon and T-DNA tagging Genetic Engineering of PlantsAgrobacterium transformationThe bacteria Agrobacterium tumefaciens causes galls or tumors on plants Genomic DNA Ti Plasmid (tumor inducing) T-DNA (transfer) Restrict and ligate together Foreign DNA T-DNA (transfer) Re-introduce recombinant DNA Agrobacterium transformation 2 Infect plant with recombinant agrobacterium Grow up transformed plants from single cells Whole T-DNA transferred randomly into plant chromosome “GENETIC ENGINEERING” without AGROBACTERIUM All involve getting DNA directly across the plasma membrane Shock of protoplasts Micro-injection Biolistics Transformation constructs or cassettes •Genes of interest •Promoter •Selectable (marker) gene Gene of interest T-DNA Promoter e.g. Cauliflower Mosaic Virus 35S RNA gene promoter (CAM 35S) T-DNA Selectable marker-gene e.g. antibiotic resistance or herbicide resistance Allows transgenic cells to be selected from non-transgenic From transformed cells to plants Plant cells are grown as a callus of undifferentiated cells on agar plates transformation After transformation, cells grown on selective media (e.g. containing antibiotic) selection Untransformed cells die Transfer to tube with hormones Cells containing transgenes grow into plantlets Transgenic plants as a research tool for non-genetic studies e.g. aequorin transformed plants to study calcium’s role as secondary messenger The aequorin gene from a luminescent jellyfish produces a protein aequorin. When combined with a small chromophore, coelentrazine, the complex gives off blue light at a rate dependent on [Ca2+]. When transformed in to tobacco, this gene can be used to study the role of [Ca2+] in signal transduction Tobacco Transient increase in luminescence of tobacco plant challenged with fungal elicitor. Ca2+ involved in pathogen recognition Luminescence Aequorin Time Knight et al. 1991 Transgenic plants to identifying gene function through novel expression eg -3fatty acid desaturase from Arabidopsis in tobacco •-3fatty acid desaturase converts 16:2 and 18:2 dienoic fatty acids to 16:3 and 18:3 trienoic acids. •A greater degree of fatty acid unsaturation (especially in the chloroplast) was thought to confer greater resistance to cold in plants. Growth after cold shock relative to control •Transformation of tobacco (which lacks the enzyme) with the enzyme from Arabidopsis, increases fatty acid unsaturation. Untransformed Transformed -3fatty acid desaturase transformation confers cold tolerance, confirming that unsaturation is important. Transgenic plants to identify gene function through over expression e.g. over-expression of antioxidant proteins The Halliwell-Asada pathway O2.- Superoxide Dismutase H2O2 Ascorbate peroxidase H2O MDHA Ascorbate DHA Dehydroascorbate reductase GSSG GSH NADP+ Glutathione reductase NADPH The Halliwell-Asada pathway is important in detoxifying reactive oxygen intermediates. These are produced naturally by the electron-transport chains of mitochondria and especially chloroplasts. Most stresses cause increases in superoxide or hydrogen peroxide production. Transgenic experiments have investigated the importance of these enzymes in stress resistance. Transgenic plants to identify gene function through over expression e.g. over-expression of antioxidant proteins Gene Construct Host Superoxide Dismutase Chloroplastic Tobacco Mitochondrial Cytosolic Tomato Potato Alfalfa Tobacco Alfalfa Potato Plant Phenotype No protection from MV or O3 Reduced MV damage and photoinhibition Reduced MV damage by no protection of photoinhibition No protection from photoinhibition Reduced MV damage Reduced aciflurofen, freezing and drought damage Reduced MV damage in the dark Reduced freezing and drought damage Reduced MV damage Ascorbate Peroxidase Cytosoloc Tobacco Chloroplastic Tobacco Reduced MV damage and photoinhibition Reduced MV damage and photoinhibition Glutathione Reductase E. coli in c.plast Tobacco Poplar E. coli in cytosol Tobacco Reduced MV and SO2 damage, not O3 Reduced photoinhibition Reduced MV damage Pea Tobacco Reduced O3 damage, variable with MV MV = methyl viologen = paraquat Allen et al. 1997 Transgenic Plants to identifying gene function through gene repression e.g. polygalacturinase and fruit ripening in tomato •Polygalacturinase breaks down cell walls. •It’s expression is considerably enhanced in ripening fruit (it makes the fruit soft). •Transformation of tomatoes with the anti-sense version (the gene in the opposite direction), reduces the expression of polygalacturinase. Sense and anti-sense mRNAs hybridise in the cytoplasm and cause large Anti-sense mRNA reductions in expression Sense mRNA Polygalacturinase activity Result- tomatoes don’t soften so quickly- FLAVR SAVR TOMATO Untransformed Transformed Time Transgenic plants to study of promoter function through reporter gene studies e.g. ABA responsive promoter from barley Section of the upstream region of a barley ABA responsive gene CCGGCTGCCCGCCACGTACACGCCAAGCACCCGGTGCCATTGCCACCGG -104 -56 (Shen and Ho 1997) Minimal promoter Reporter gene (GUS) ABA responsiveness GUS activity in the presence of ABA related to no ABA 1x 38x 24x 55x 87x Mutants and Plant Genetics DNA damage- X and Gamma rays, sodium azide (NaN3) Transposons and T-DNA tagging The Ac transposable element of maize 11-bp inverted repeats Cis-determinants for excision Exons of transposase gene Introns A transposon can move at random throughout a plant genome. It is cut out of its site and reinserted into another site by the action of an endonuclease and the transposase. Insertion into a functional gene causes mutation. Transposons and T-DNA tagging Transposons have only been found in a few plants (e.g. Maize, Antirrhium). But, they can be introduced by transformation. The Ac transposon has been introduced to tobacco, Arabidopsis, potato, tomato, bean and rice. Mutations using transposons or T-DNA (both of which insert randomly into nuclear DNA) are produced by transformation methods described earlier. Large numbers of plants are screened for an observable phenotype (e.g. lack of response to light). Screen Identify mutated gene Transposons and T-DNA tagging The gene into which the insert has occurred can be recovered by PCR Mutated ORF Insertion (Transpososn or T-DNA) Restrict Ligate PCR amplify using primers homologous to and facing out of insert