* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download protein - Warren County Schools
Real-time polymerase chain reaction wikipedia , lookup
Peptide synthesis wikipedia , lookup
Western blot wikipedia , lookup
RNA interference wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
Non-coding DNA wikipedia , lookup
Protein–protein interaction wikipedia , lookup
RNA silencing wikipedia , lookup
Metalloprotein wikipedia , lookup
Eukaryotic transcription wikipedia , lookup
RNA polymerase II holoenzyme wikipedia , lookup
Transcriptional regulation wikipedia , lookup
Protein structure prediction wikipedia , lookup
Amino acid synthesis wikipedia , lookup
Polyadenylation wikipedia , lookup
Two-hybrid screening wikipedia , lookup
Silencer (genetics) wikipedia , lookup
Proteolysis wikipedia , lookup
Biochemistry wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
Deoxyribozyme wikipedia , lookup
Nucleic acid analogue wikipedia , lookup
Point mutation wikipedia , lookup
Gene expression wikipedia , lookup
Messenger RNA wikipedia , lookup
Genetic code wikipedia , lookup
Protein Synthesis DNA Transcription and Translation What is the purpose for proteins? We are made of protein! • • • • • • • antibody: fight diseases Muscle contractions Enzymes Hormones Hair, feathers, beaks, nails, horns, etc. Egg whites Transport proteins: blood(hemoglobin) Protein Structure • Made up of amino acids • Polypeptide- string of amino acids • ONLY 20 amino acids are arranged in different orders to make a variety of proteins!!!! Amino acids are in the cytoplasm. • Assembled on a ribosome How Does Our Body Create Proteins from DNA?? Its in the nucleus!!!!!! Introduction The Central Dogma of Molecular Biology Cell DNA Transcription mRNA Translation Ribosome Polypeptide (protein) DOGMA? This central dogma(process) was develop by Crick. This was a hypothesis on how the code was read from DNA then used to make proteins. Scientists did not like this term for this hypothesis because it sounds like a problem! Central Dogma of Biology The flow of information in the cell starts at DNA, Location???? • Prokaryotic Cyotoplasm and ribosomes • Eukaryotic Nucleus and ribosomes DNA vs. RNA(players) • DNA • Double Helix • Deoxyribose sugar • Adenine pairs with Thymine (A-T) • Stays in nucleus • RNA • Single strand • Ribose sugar • Uracil replaces Thymine! • Leaves nucleus to do the work DNA vs. RNA DNA Deoxyribose Thymine RNA Ribsose Double Strand Single Strand Uracil is one of the bases in RNA. There is thymine no thymine. This means A goes with U and G still goes with C. Steps to Protein Synthesis 1. Transcription – process where DNA message is changed into mRNA then out of nucleus to the ribosomes!!! 2. Translation – process when mRNA is translated into amino acid chains(protein) on the ribosomes. Transcription??? • Purpose? • Creating? • WHY WHY WHY!!!!!! How does a protein get built?? • This is where RNA becomes involved. • DNA is too large to get out of the nuclear membrane pores. • SO RNA has to be made to go to the ribosomes!!! SO, HOW DOES AN AMINO ACID CHAIN GET BUILT? RNA stands for ribonucleic acid Stars of Translation and Transcription 1. 2. 3. 4. 5. 6. mRNA DNA rRNA tRNA Ribsomes RNA polymerase • • • • Three types of RNA: 1. mRNA • 2. tRNA “messenger” RNA • “transfer” RNA Carries code for • Attaches specific proteins from DNA Amino Acids to the Carries “codon” protein chain by matching the mRNA codon with the anticodon. RNA TRANSCIPTION There are three (3) types RNA: 1. Messanger RNA – (mRNA) carries messages from the DNA in the nucleus to the ribosomes. tRNA 2. Transfer RNA – (tRNA) 20 different kinds which are only able to bond with one (1) specific type of amino acid. rRNA 3. Ribosomal RNA – (rRNA) major component (part) of the ribosomes 3. Ribosomal RNA - rRNA • Where Protein synthesis occurs How Does RNA polymerase(complex) know where to start and stop? • Promoter site: starting and stopping point on DNA. Specific base sequences that represents a gene. • Termination site: Place where RNA polymerase stops!!! • REMEMBER - only a gene is being read to make mRNA not all of your DNA. Step 1: • RNA polymerase complex attaches to DNA at special places that serve as the start signal(promoter sites). Only one gene!!!!! Step 2: • DNA splits at site of RNA polymerase. • RNA polymerase attaches matching bases to form new RNA strand from DNA template. • RNA polymerase keeps adding bases making the RNA strand grow… Step 3: • RNA polymerase leaves DNA when reaches the termination site(stop signal). • RNA strand is released and goes to cytoplasm. • DNA rewinds itself into the double helix. Results of Transcription • Strand of mRNA made from the DNA FYI RNA polymerase doesn’t check for mistakes in the code. Doesn’t cause mutations when there is a few mistakes in proteins unlike replication. Protein Synthesis: Transcription Making mature mRNA Original mRNA transcribed is not mature mRNA Exons: readable segments of mRNA that will be spliced together to make mature mRNA. Introns: are non- readable segments of mRNA that must be removed before it leaves the nucleus Exons vs. Introns Once introns removed, mRNA is ready to leave the nucleus!!!! Eukaryotic Transcription Cytoplasm DNA Transcription RNA RNA Processing mRNA G G AAAAAA Nucleus Export AAAAAA Prokaryotic Protein Synthesis • All occurs in the cyotplasm!!! Transcription is done…what now? Now we have mature mRNA transcribed from the cell’s DNA. It is leaving the nucleus through a nuclear pore. Once in the cytoplasm, it finds a ribosome so that translation can begin. We know how mRNA is made, but how do we “read” the code? Translation Translation is the process of decoding a mRNA molecule into a polypeptide chain or protein. ALWAYS read mRNA!!!!!! Reading Frame • Every 3 DNA bases pairs with 3 mRNA bases • Every group of 3 mRNA bases encodes a single amino acid • Codon- coding triplet of mRNA bases Codons • Each combination of 3 nucleotides on mRNA is called a codon or threeletter code word. • Each codon specifies a particular amino acid that is to be placed in the polypeptide chain (protein). Protein Synthesis: Translation Start codons and Stop codons • For translation to begin, there is a START codon. • AUG: is the 3 letter codon that starts the process. • UAA, UGA, UAG: Stop codons. A Codon OH P HO NH2 O N O N CH2 H P O O N O CH2 P NH N Guanine NH2 N O Arginine H O HO N O O HO Adenine N NH2 O N O CH2 N O OH H N N Adenine Protein Synthesis: Translation Start Codon • Start codon: codon AUG also serves as the “initiator” codon, which starts the synthesis of a protein. Stop Codon • STOP codon: Codon that signal the end of the protein. (UAA, UAG, & UGA • Besides selecting the amino acid methionine, the codon AUG also serves as the “initiator” codon, which starts the synthesis of a protein Protein Synthesis: Translation •A three-letter code is used because there are 20 different amino acids that are used to make proteins. •If a two-letter code were used there would not be enough codons to select all 20 amino acids. •That is, there are 4 bases in RNA, so 42 (4x 4)=16; where as 43 (4x4x4)=64. Translation •Therefore, there is a total of 64 codons with mRNA, 61specify a particular amino acid. • This means there are more than one codon for each of the 20 amino acids. Protein Synthesis: Translation Transfer RNA (tRNA) •Each tRNA molecule has 2 important sites of attachment. •One site, called the anticodon, binds to the codon on the mRNA molecule. •The other site attaches to a particular amino acid. •During protein synthesis, the anticodon of a tRNA molecule base pairs with the appropriate mRNA codon. tRNA • Transfer RNA • Bound to one amino acid on one end • Anticodon on the other end complements mRNA codon Met-tRNA Methionine 16 Pu 17 9 A 17:1 13 12 Py 10 1 2 3 4 5 6 U* 7 A C C 73 72 71 70 69 68 67 Py 59A* 66 65 64 63 62 C Pu 49 50 51 52 G T C y Py G* 22 23 Pu 25 G 26 2020:120:2A 27 1 28 29 30 31 Py* 47:16 47:15 43 44 42 45 41 46 47 40 47:1 39 38 Pu* U 34 U 35 C A 36 Anticodon Protein Synthesis: Translation Parts of a Ribosomes • For translation to begin, 2 subunits of ribsosomes must unite, separate in cytoplasm – Large – Small • Contain 3 binding sites – helps tRNA align to codon. –E –P –A Protein Synthesis: Translation RNA TRANSLATION Protein Synthesis: the formation of a protein using information coded on DNA and carried out by RNA in the assembly of amino acids. Proteins are: a. Amino acids in chains – 20 kinds b. Made of 10’s or 100’s or 1000’s of amino acids c. Must be arranged in a specific sequence for each type of protein d. Function & type of protein is determined by amino acid sequence e. DNA makes RNA f. RNA constructs amino acids Steps of Translation • 1. INITIATION: A.The initiator(start) codon AUG binds to the first anticodon of tRNA, signaling the start of a protein. B. Two parts of the ribosome join around the tRNA and mRNA. • The amino acid methionine, the codon AUG also serves as the “initiator” codon, which starts the synthesis of a protein Translation • 2. ELONGATION: The anticodon of another tRNA binds to the next mRNA codon, bringing the 2nd amino acid to be placed in the protein. This will continue until stop codon. • As each anticodon & codon bind together a peptide bond forms between the two amino acids. Protein Synthesis: Translation 3. Termination: The protein chain continues to grow until a stop codon reaches the ribosome, which results in the release of the new protein and mRNA, completing the process of translation. The amino acids are bonded with a peptide bond to form a protein. •Release factor causes the release of tRNA and mRNA. Summary of Translation • • • • Ribosome 2 parts come together. mRNA attaches to ribosome. AUG – start codon. tRNA brings in making anticodon with amino acid. • rRNA continues to read mRNA and bring in making tRNA. *Stop codon will stop process. Peptide bonds will form to make a protein. tRNA Function • Amino acids must be in the correct order for the protein to function correctly • tRNA lines up amino acids using mRNA code Protein Synthesis: Translation Transfer RNA (tRNA) •Each tRNA molecule has 2 important sites of attachment. •One site, called the anticodon, binds to the codon on the mRNA molecule. •The other site attaches to a particular amino acid. •During protein synthesis, the anticodon of a tRNA molecule base pairs with the appropriate mRNA codon. Met-tRNA Methionine 16 Pu 17 9 A 17:1 13 12 Py 10 1 2 3 4 5 6 U* 7 A C C 73 72 71 70 69 68 67 Py 59A* 66 65 64 63 62 C Pu 49 50 51 52 G T C y Py G* 22 23 Pu 25 G 26 2020:120:2A 27 1 28 29 30 31 Py* 47:16 47:15 43 44 42 45 41 46 47 40 47:1 39 38 Pu* U 34 U 35 C A 36 Anticodon Translation - Initiation fMet Large subunit E P A UAC 5’GAG...CU-AUG--UUC--CUU--AGU--GGU--AGA--GCU--GUA--UGA-AT GCA...TAAAAAA Small mRNA subunit 3’ Translation - Elongation Polypeptide Met Phe Leu Ser Gly Arg Ribosome E P A CCA UCU 5’GAG...CU-AUG--UUC--CUU--AGU--GGU--AGA--GCU--GUA--UGA-AT GCA...TAAAAAA mRNA 3’ Translation - Elongation Polypeptide Met Phe Leu Ser Gly Arg Aminoacyl tRNA Ribosome E P A CCA UCU 5’GAG...CU-AUG--UUC--CUU--AGU--GGU--AGA--GCU--GUA--UGA-AT GCA...TAAAAAA mRNA 3’ Translation - Elongation Polypeptide Met Phe Leu Ala Ser Gly Aminoacyl tRNA Arg Ribosome E P A CCA UCU 5’GAG...CU-AUG--UUC--CUU--AGU--GGU--AGA--GCU--GUA--UGA-AT GCA...TAAAAAA mRNA 3’ Translation - Elongation Polypeptide Met Phe Leu Ser Gly Arg Ribosome E Ala P A UCU CGA 5’GAG...CU-AUG--UUC--CUU--AGU--GGU--AGA--GCU--GUA--UGA-AT GCA...TAAAAAA mRNA 3’ Protein Synthesis: Translation The Genetic Code ACGATACCCTGACGAGCGTTAGCTATCG UGC ACUG UAUGGG Protein Synthesis: Translation Protein Synthesis AMINE H H O N ACID C C ANYTHING R H Amino Acid Alanine OH H H Serine H O N C OH H C H H H H2O H H C H H C H O C C C C HO N H N H H C O N H O C C H H C H H HO H OH OH Transcription And Translation In Prokaryotes 5’ 3’ 3’ 5’ RNA Pol. Ribosome mRNA 5’ Ribosome Transcription vs. Translation Review Transcription • Process by which genetic information encoded in DNA is copied onto messenger RNA • Occurs in the nucleus • DNA mRNA Translation • Process by which information encoded in mRNA is used to assemble a protein at a ribosome • Occurs on a Ribosome • mRNA protein Protein Synthesis AMINE H H O N ACID C C ANYTHING R H Amino Acid Alanine OH H H Serine H O N C OH H C H H H H2O H H C H H C H O C C C C HO N H N H H C O N H O C C H H C H H HO H OH OH Translation - Elongation Polypeptide Met Phe Leu Ser Gly Arg Ribosome E P A CCA UCU 5’GAG...CU-AUG--UUC--CUU--AGU--GGU--AGA--GCU--GUA--UGA-AT GCA...TAAAAAA mRNA 3’ Prokaryotic - Protein synthesis • Location – cytoplasm • At the same time. • Eukaryotic – Protein synthesis Transcription And Translation In Prokaryotes 5’ 3’ 3’ 5’ RNA Pol. Ribosome mRNA 5’ Ribosome (1961) Watson & Crick proposed… • …DNA controlled cell function by serving as a template for PROTEIN structure. • 3 Nucleotides = a triplet or CODON (which code for a specific AMINO ACID) See p.303 • AMINO ACIDS are the building blocks of proteins. MUTATIONS Changes in DNA that affect genetic information Gene Mutations • Point Mutations – changes in one nucleotides 1. Substitution – base is replaced • THE FAT CAT ATE THE RAT • THE FAT HAT ATE THE RAT Gene Mutations 2. Insertion – a base is added • THE FAT CAT ATE THE RAT • THE FAT HCA TAT ETH ERA T 3. Deletion – delete a base THE FAT CAT ATE THE RAT TEF ATC ATA TET GER AT Point Mutations that cause Frameshift Mutations – shifts the reading frame of the genetic message so that the protein may not be able to perform its H function. Effects of Mutations • Silent – When a base pair is substituted but the change still codes for the same amino acid in sequence. NO CHANGE!!! Effects 0f Mutations • Missense –Mutation that causes a changed amino acid. Usually harmful!!! • EX: sickle cell amenia Effects of Mutations • Nonsense – Mutation that does not allow protein to form because of early stop codon Sex Chromosome Abnormalities • XYY Syndrome – Normal male traits – Often tall and thin – Associated with antisocial and behavioral problems Chromosome Mutations • Changes in number and structure of entire chromosomes • Original Chromosome ABC * DEF • Deletion AC * DEF • Duplication ABBC * DEF • Inversion AED * CBF • Translocation ABC * JKL GHI * DEF Significance of Mutations • Most are neutral • Eye color • Birth marks • Some are harmful • Sickle Cell Anemia • Down Syndrome • Some are beneficial • Sickle Cell Anemia to Malaria • Immunity to HIV What Causes Mutations? • There are two ways in which DNA can become mutated: – Mutations can be inherited. • Parent to child – Mutations can be acquired. • Environmental damage • Mistakes when DNA is copied Chromosome Mutations • Down Syndrome – Chromosome 21 does not separate correctly. – They have 47 chromosomes in stead of 46. – Children with Down Syndrome develop slower, may have heart and stomach illnesses and vary greatly in their degree of inteligence. Chromosome Mutations • Cri-du-chat – Deletion of material on 5th chromosome – Characterized by the cat-like cry made by cri-du-chat babies – Varied levels of metal handicaps Sex Chromosome Abnormalities • Klinefelter’s Syndrome –XXY, XXYY, XXXY –Male –Sterility –Small testicles –Breast enlargement Sex Chromosome Abnormalities • XYY Syndrome –Normal male traits –Often tall and thin –Associated with antisocial and behavioral problems Sex Chromosome Mutations • Turner’s Syndrome –X – Female – sex organs don't mature at adolescence – sterility – short stature Sex Chromosome Mutations • XXX –Trisomy X –Female –Little or no visible differences –tall stature –learning disabilities –limited fertility