* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download The Play is the thing… - Biology Learning Center
Protein adsorption wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
Gel electrophoresis of nucleic acids wikipedia , lookup
List of types of proteins wikipedia , lookup
Peptide synthesis wikipedia , lookup
Protein (nutrient) wikipedia , lookup
Promoter (genetics) wikipedia , lookup
Cell-penetrating peptide wikipedia , lookup
Molecular evolution wikipedia , lookup
RNA interference wikipedia , lookup
Non-coding DNA wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
Point mutation wikipedia , lookup
Silencer (genetics) wikipedia , lookup
RNA silencing wikipedia , lookup
Polyadenylation wikipedia , lookup
Amino acid synthesis wikipedia , lookup
Transcriptional regulation wikipedia , lookup
Eukaryotic transcription wikipedia , lookup
RNA polymerase II holoenzyme wikipedia , lookup
Bottromycin wikipedia , lookup
Biochemistry wikipedia , lookup
Deoxyribozyme wikipedia , lookup
Messenger RNA wikipedia , lookup
Gene expression wikipedia , lookup
Nucleic acid analogue wikipedia , lookup
Genetic code wikipedia , lookup
Non-coding RNA wikipedia , lookup
Expanded genetic code wikipedia , lookup
www.grimmy.com/ Transcription & Translation •Transcription: writing again •Translation: changing languages Today we’ll go from here... Text To here Off to see the Sendingwizard... ‘messages’ out from DNA • DNA replication – both strands => new DNA – => new cell • Transcription – 1 strand => new RNA – => new protein 20 toys • • • • EVERY one has a blue part. Chem name? EVERY one has a red part. Chem name? Thus these are all…? How many are there? Amino Acids • How are they similar? • How are they different? • What do the differences mean in terms of “feel”? • How many are there? • Possible? Amino Acids • You & partner have an amino acid; which is it? (StructViewer or homepage => left column ‘big twenty’ amino acids) Nucleic Acids • How are they similar? • How are they different? • What do the differences mean in terms of “feel”? • Which is more diverse in terms of shape and ‘feel’? • Which would allow for more diverse shapes and surfaces when ‘connected’? How does a codon ‘mean’ an amino acid? The Play is the thing… The Play is the thing… Or, Fun With Blocks The Play is the thing… • ‘Types of Bonds’ – Velcro – can be easily broken/re-made during lab – Duct tape – breaking it gets you and zero (0) for this week’s quiz The Play is the thing… • The Players The Play is the thing… • The Players – tRNA The Play is the thing… • The Players – tRNA – Ribosome The Play is the thing… • The Players – tRNA – Ribosome – Aminoacyl tRNA synthetase The Play is the thing… • The Players – tRNA – Ribosome – Aminoacyl tRNA synthetase – RNA polymerase The Play is the thing… • The Players – tRNA (4 people) – Ribosome (1) – Aminoacyl tRNA synthetase (4) – RNA polymerase (1-2) * and RNA – Termination factor (1) Blinding you with Science (jargon) RNA Polymerase: joins RNA links into a chain mRNA: messenger RNA; RNA string copied (‘transcribed’) from DNA tRNA: transfer RNA; one of many RNA molecules that carry specific amino acids ribosome: giant machine (>200 proteins, 4 RNAs (2 > 1000 nucleotides) that oversees the reading of the mRNA and the creation of polypeptide aminoacyl tRNA synthetase: protein machine adds amino acid to tRNAs Termination factor: ‘reads’ UAA etc., => ribosome looses the peptide & falls apart Learning your ‘lines’ • Handout: Each group find questions related to their role; answer them • Lab manual, textbook, internet OK as sources • Meet your blocks-- 5’ is the end that sticks to hair, socks, shirts 5’ end is pointy/spiky 3’ end is soft/furry DNA Template • 5’ CTTAAATCCGAATGCCCATG 3’ 5’ is “sticky”, 3’ is “fuzzy” 5’ CTTAAATCCGAATGCCCATG 3’ 5’ is “sticky”, 3’ is “fuzzy” Wielding the Power • ‘Recall’ that ribosome assembly is the result of methionine tRNA finding a match on mRNA in presence of small ribosome subunit • Only methionine tRNA (it will ‘know itself’ once crowned by the synthetase that hands out met) can team with small ribosomal subunit & join with the ‘AUG’! Ready…. Go! • mRNA at the central bench • ribosome assembles around it • synthetases at bench corners (or ‘diffuse’ opp. direction vs. tRNA) • tRNAs will ‘diffuse’ by following a path through the room • When any event first happens*, action stops, molecules involved will announce, explain • Go until a protein happens “Who” knows what’s going on? • What happens if a tRNA carries the wrong amino acid? • What happens if the mRNA contains a copy error relative to DNA? • What happens if a tRNA has a mutated anticodon Exit Condition 1.) Pair up (two in a group) 2.) Write your names and SECTION at the top of the paper 3.) EXPLAIN the process of TRANSLATION Include the following in your answer: tRNA mRNA Ribosome AUG codon RNA polymerase Aminoacyl tRNA synthetase Termination factor diffusion Meet your new best friend Protocol: (1) Put a ½ inch layer of milk into a picnic plate (2) Add a drop of each of several food colorings at different locations towards the perimeter (3) Touch a wooden stick to a dab of dishwashing detergent (4) Touch the detergent to the center of the milk (5) Observe! WHAT DID YOU SEE? -Hypothesize: What all is going on? How can you test your