* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download RNA - Mr. Dudley's Website
Molecular cloning wikipedia , lookup
Peptide synthesis wikipedia , lookup
Community fingerprinting wikipedia , lookup
Gel electrophoresis of nucleic acids wikipedia , lookup
RNA interference wikipedia , lookup
Promoter (genetics) wikipedia , lookup
Cell-penetrating peptide wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
List of types of proteins wikipedia , lookup
Non-coding DNA wikipedia , lookup
Eukaryotic transcription wikipedia , lookup
RNA polymerase II holoenzyme wikipedia , lookup
RNA silencing wikipedia , lookup
Molecular evolution wikipedia , lookup
Point mutation wikipedia , lookup
Silencer (genetics) wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
Bottromycin wikipedia , lookup
Transcriptional regulation wikipedia , lookup
Polyadenylation wikipedia , lookup
Amino acid synthesis wikipedia , lookup
Deoxyribozyme wikipedia , lookup
Gene expression wikipedia , lookup
Non-coding RNA wikipedia , lookup
Nucleic acid analogue wikipedia , lookup
Biochemistry wikipedia , lookup
Transfer RNA wikipedia , lookup
Genetic code wikipedia , lookup
Expanded genetic code wikipedia , lookup
RNA Structure and Transcription and Translation RNA is also known as Ribonucleic Acid mRNA- Messenger RNA. Carries instructions from the nucleus to ribosomes. tRNA- Transfer RNA. Carries specific amino acids to the ribosome rRNA- Ribosomal RNA. Component of ribosome, connects amino acids together. Types and Functions rRNA tRNA mRNA Single-stranded polymer of nucleotides Single Helix Sugar-Phosphate backbone ◦ Ribose Sugar 4 types of nitrogen bases ◦ ◦ ◦ ◦ Adenine Guanine Cytosine Uracil Takes the place of Thymine Structure "DNA makes RNA and RNA codes for amino acids that are put together to make proteins“ Use this analogy: ◦ ◦ ◦ ◦ ◦ DNA is like a book Chromosomes are like chapters of a book Genes are like sentences in a chapter Codons are like words of a sentence Amino acids are like the meaning of the words Central Dogma of Molecular Biology All of a humans DNA. Divided into 23 pairs of chromosomes. Specific sections of chromosomes are called genes. Genes can be 3000-2.4 million basepairs long. Protein Synthesis Overall Creating mRNA from DNA DNA does not leave the Nucleus The DNA code needs to “written” in RNA form that can leave the nucleus Process is similar to DNA replication on the leading strand. Transcription Uses one strand of the DNA double helix as a template: DNA Template AAGCTATACGGCAGTGAACCTGT UUCGAUAUGCCGUCACUUGGAA RNA Sequence Transcription The mRNA molecule leaves the nucleus and travels to a ribosome in the cytoplasm. The mRNA molecule is “read” by the ribosome three bases at time. These are called codons. Each one codes for a different amino acid Translation Translation Amino acids are carried to the ribosome by tRNA molecules The top part of a tRNA molecule carries the amino acid The bottom part has a 3 letter segment of RNA called an “anti-codon” The anti-codon complements the codon on the mRNA Translation tRNA Small organelles in the cytoplasm that assemble amino acids together to create proteins Composed of two sub-units of rRNA and proteins The Ribosome The small subunit reads the mRNA three letters at a time The large subunit attaches the amino acids together Three bonding sites: ◦A site (aminoacyl site) ◦P site (peptidyl site) ◦E site (Ejection site) ◦ *Just remember APE* The Ribosome The correct tRNA Attaches at the A site The tRNA then moves the the P site where its amino acid is Put onto the growing chain The tRNA is the Ejected at the E site Binding Sites Raw sequence of mRNA transcribed from DNA is actually Pre-mRNA and needs to be modified before it can be read by the ribosome. Pre-mRNA Modifications First, a “5’ cap” is added to the 5’ end of the pre-mRNA ◦ Helps mRNA exit the nuclear pores Allows transport proteins to attach to the mRNA strand ◦ Helps to prevent degradation of mRNA ◦ Helps mRNA “find” a ribosome mRNA Modifications Then a “poly-A” tail is added to the 3’ end A long 80-150 bases of Adenine are added to the 3’ end ◦ Helps to prevent degradation of mRNA ◦ Helps with ending translation at the ribosome mRNA Modification Not all of the mRNA actually codes for chains of amino acids. Segments that DO NOT code for amino acids are called Introns Segments that DO code for amino acids are called Exons ◦ Introns will be completely removed from an mRNA molecule ◦ This is called “splicing” Exons and Introns