* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download DNA Science - University of Missouri
Genetic code wikipedia , lookup
Restriction enzyme wikipedia , lookup
Promoter (genetics) wikipedia , lookup
Agarose gel electrophoresis wikipedia , lookup
Transcriptional regulation wikipedia , lookup
Zinc finger nuclease wikipedia , lookup
SNP genotyping wikipedia , lookup
DNA profiling wikipedia , lookup
DNA repair protein XRCC4 wikipedia , lookup
Genetic engineering wikipedia , lookup
Two-hybrid screening wikipedia , lookup
Real-time polymerase chain reaction wikipedia , lookup
Bisulfite sequencing wikipedia , lookup
Gene expression wikipedia , lookup
Genomic library wikipedia , lookup
Silencer (genetics) wikipedia , lookup
Community fingerprinting wikipedia , lookup
Endogenous retrovirus wikipedia , lookup
Biosynthesis wikipedia , lookup
Gel electrophoresis of nucleic acids wikipedia , lookup
Molecular cloning wikipedia , lookup
Transformation (genetics) wikipedia , lookup
Point mutation wikipedia , lookup
Nucleic acid analogue wikipedia , lookup
DNA supercoil wikipedia , lookup
Non-coding DNA wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
DNA Science MU Plant Genome Research Experience for Teachers Workshop Friedrich Miescher First to extract DNA from nuclei (1869). First to ID DNA as a distinct molecule. Source of DNA was white blood cells (WBC). WBCs are commonly found in infected wounds. Friedrich Miescher (cont.) Called the substance he isolated nuclein. It was high in phosphorus. Thought main function was to store phosphorus. The Transforming Principle Avery, Macleod, and McCarty (1943) discovered different strains of bacteria had different effects on a mouse. Transforming Principle (cont.) What was the transforming principle from the dead virulent strain that made the avirulent strain lethal? Separate the dead virulent strain into fractions and coinject with avirulent strain. The DNA fraction contained the transforming principle. Controversial result because at that time most scientists thought proteins were the hereditary material. Chargaff Principle In 1950 found that whatever tissue he took DNA from the percentage of each nucleotide was the same. (%G = %C, %A = %T) Add Some Herstory to History! Early 1950’s: Rosalind Franklin, John Randall & Maurice Wilkins (King's College, London) made beautiful X-ray diffraction pictures of DNA fibers. Rosalind Franklin showed her DNA x-ray diffraction pictures to Watson and Crick. X-rays diffract X-ray source X-rays diffract “Mad Hatters Who Bubble Over About Their New Structure” Taken from G. Pomerat’s Diary (Apr 1953): DNA Double Helix, W&C Nature 1953 “… Watson and Crick ….have got the structure of nucleic acid from a crystallographic rather than a chemical standpoint. Their clue came out of the beautiful x-ray diagrams produced in Randall’s lab… They are just putting the finishing touches on a huge model about six feet tall which shows that the molecule is made up of two helical chains…” R. Franklin’s X-ray Picture http://vector.cshl.org/resources/pomerat.html Remembering Rosalind: British Award Honors Rosalind Franklin Watson and Crick publish Nature paper reporting DNA double helix (based in part on Rosalind’s DNA pictures) in 1953. Watson, Crick and Wilkins were awarded 1962 Nobel Prize for DNA double-helix. Rosalind Franklin was not awarded the Nobel Prize, she died in 1958 (37 years old) of ovarian cancer. The Franklin Medal now honors Rosalind’s critical role in the discovery of DNA double helix. 2003: 50 Year Anniversary of the Discovery of The DNA Double Helix The famous DNA Double Helix paper was published in Nature in 1953! The Double Helix Two strands of DNA run in opposite directions, complementing each other and pairing with hydrogen bonds. A and T pair together and C and G pair together. Helix is most often right-handed (B-form). What Is DNA? DNA is a chemical contained in every cell of your body. DNA is a Chemical!? Yes! What other kinds of chemicals are in your body? •We are made up of chemicals, formed from the elements carbon (C), hydrogen (H), oxygen (O), phosphate (P) and others •DNA is made up of carbon (C), hydrogen (H), oxygen (O), phosphate (P) •We breathe air which contains oxygen molecules (O2). •We eat food which is composed of chemicals called proteins, sugars, and fats. •Our bones are made up largely of calcium (Ca) •Our bodies make energy by breaking down chemicals such as sugar! •We store energy in our body in the form of carbohydrate chemicals. DNA Hereditary material. Contains all information to make proteins. Linear polymer of nucleotide. Each one has sugar, phosphate and a base. DNA Base connected to sugar by β-glucosyl linkage. Nucleotides are connected to one another by a phosphodiester bond. Bases are perpendicular to helix. Four Bases A=Adenine T=Thymine C=Cytosine G=Guanine What Does DNA Look Like? 3D DNA Helix Molecule •The spheres represent the actual positions of atoms in the DNA molecule. •All the atoms together make up the entire DNA molecule. •DNA molecule contains 2 DNA polymers twisted around each other to make the DNA helix DNA HELIX (Tutorial) 3D DNA Double Helix: Two Long DNA Strands DNA Double Helix: Two DNA Strands Twisted Around Each Other “Green” DNA Strand “Red” DNA Strand 3D DNA Strands: Backbone DNA Strands: Each DNA Strand Contains One Backbone and Building Block Bases DNA Backbones are Shown in Dark Green and Dark Red 3D DNA Strands: Building Blocks are DNA Letters Each DNA Strand Contains One Backbone and Many Building Block DNA Letters (Bases) “Green” DNA Strand DNA Letters: A, G, C, T “Red” DNA Strand How Does DNA Carry Information? To answer this question we must take a closer look at DNA. DNA is a biopolymer •Polymers are molecules made of repeating units or building blocks •DNA has four chemical building blocks symbolized by the letters A,G,C,& T •The letters of your DNA are in a specific order that carries information about you!! So, a DNA polymer can be represented as a string of letters: AG C T TAG G G TAAAC C CATATA DNA Carries Information in the Sequence of DNA Letters . . .A G C T T A G G G T A A A C C C A T A G . . . A gene • A gene is a length of DNA letters that contain an instruction for a cell to follow. • The cell uses specially designed protein machines to read the information in genes. The Order of DNA Letters Encodes the Genetic Information The order or sequence of the A, G, C and T letters in the DNA polymer encodes the actual genetic information Example of the DNA letters in a gene: AGCTTAGGGTAAACCATATAGGGCCATACCCTATCGGTAAGCTT The specific order of the DNA letters carries the information. • Changing the order of the DNA letters will change the information carried by the gene. • We will talk about how this happens later! AGCTTAGGGAAAACCCATATAGGGCCATACCCTATCGGTAAG Secret of DNA Fingerprinting Lies in the Ability to Detect Small Differences in DNA Letters Among Individual Samples Look around the room and see how different we all look. Then compare any two human genomes: •The DNA letters are almost the identical order (sequence) between any two human genomes! •A very small number (0.1%) of the DNA letters differ between any two human genomes. •Two plants that look very similar may be close or distantly related because humans select for desirable traits in new varieties. Genes Can Have Hundreds to Millions of DNA Letters . . .A G C T T A G G G T A A A C C C A T A G . . . A gene It can take hundreds, thousands or even a million or more letters (bases) to “spell out” the instructions in a single gene. …and what for? Controlling Gene Expression The specific order of DNA bases in a gene encode a protein product. Genes have START and STOP signals that specify the length of the protein chain. Control DNA region is in front of the “coding region” and controls expression of the gene. GENE Control DNA region is called a promoter. +1 PROMOTER mRNA DNA region carrying protein information is called the coding region. PROTEIN CODING REGION Genes Contain Instructions for Building Proteins Genes contain instructions for making proteins, one of the major types of the molecules of life, or “biomolecules” Proteins, like DNA, are polymers • Protein building blocks are called amino acids • Amino acids are strung together into long, linear polymers by following the instructions in genes • In general, a gene encodes the instructions for one protein When a gene is “misspelled,” the protein made from it • may be made with an incorrect amino acid • may not work properly Review of Gene Expression Pathway in Cells GENE DNA mRNA copy of gene mRNA goes to cytoplasm Focus on the Genetic Code! Ribosomes translate genetic information encoded in the mRNA into protein building blocks (chains of amino acids) Protein folds into 3D active structure Protein functions in cell DNA Code Is Copied into a “Portable” Code: mRNA RNA POLYMERASE (RNAP: COPIES DNA INTO mRNA) DNA DNA C U A A G A T T 3’ Note: DNA base-pairs between backbone strands are not shown here mRNA mRNA: AUGGAGUACUAAUAUGUAAAAAAAAAAAAAAAAAAA-3’ DNA: ATGGAGTACTAATATGT-3’ TACCTCATGATTATACA-5’ MFHMAF2001 RNA Code has Different Alphabet Than DNA Code (RNA has U instead of T) DNA: ATGGAGTACTAATATGT-3’ TACCTCATGATTATACA-5’ DNA strand has “T” DNA Base-Pair 3’-TACCTCATGATTATACA-5’DNA STRAND AUGGAGUACUAAUAUGU mRNA copied from DNA RNA has U instead of T When DNA is copied into mRNA (transcription), U is incorporated into mRNA in place of T DNA Strands “Unzip” so the DNA Letters Can be “Read” -ATGGAGTACTAATATGT-TACCTCATGATTATACA- DOUBLE-STRANDED DNA (Region from Chromosome) DNA STRANDS SEPARATE -TACCTCATGATTATACAAUGGAGUACUAAUAUGU mRNA copied from DNA DNA STRANDS COME BACK TOGETHER BY BASE-PAIRING -ATGGAGTACTAATATGT-TACCTCATGATTATACADNA HELIX STAYS IN NUCLEUS + AUGGAGUACUAAUAUGU mRNA mRNA GOES TO CYTOPLASM TO PROTEIN FACTORY Genetic Code is Written in 3-Letter DNA Words (Codons) -TACCTCATGATTATACA- DNA(DNA strands separated) -AUGGAGUACUAAUAUGU mRNA (copied from DNA) 5’-AUGGAGUACUAAUAUGU mRNA 5’-AUG GAG UAC UAA UAU mRNA mRNA code “read” by ribosome in TANDEM triplets called codons. Codon adaptors convert RNA letters CODON MEANINGS: into the correct •A “START PROTEIN” SIGNAL: AUG amino acid building •A “STOP PROTEIN” SIGNAL: UAA, UGA, UAG blocks in the protein •An amino acid building block of a protein •Codons identified in the Genetic Code Table chain. The Universal Genetic Code Table Name of Building Block Amino Acid: Phe=Phenylalanine Leu=Leucine Ile=Isoleucine AUG CODON: Signal to start making the protein. http://anx12.bio.uci.edu/~hudel/bs99a/lecture20/lecture1_6.html STOP Codons: UAA UAG UGA Genetic Code is Written in 3-Letter DNA Words -TACCTCATGATTATACA- DNA STRAND AUGGAGUACUAAUAUGU mRNA copied from DNA mRNA code is “read” in TANDEM CODONS 5’-AUGGAGUACUAAUAUGU mRNA 5’-AUG GAG UAC UAA UAU mRNA Met-Glu-Tyr-STOP N Met Glu Tyr C A SHORT PROTEIN IS A PEPTIDE CODON MEANINGS: •“START PROTEIN HERE”: AUG (START) Methionine (Met) •“STOP PROTEIN HERE”: UAA, UGA, UAG •Amino acid building blocks: N-Met-Glu-Tyr-C •Codons are identified in the Genetic Code Table Proteins Have Two Ends: The N- And C- Termini 5’-AUGGAGUACUAAUAUGU mRNA 5’-AUG GAG UAC UAA mRNA Met-Glu-Tyr-STOP N Met Glu Tyr C A short protein (peptide) has only a few amino acid (aa) building blocks. The first aa in the chain (usually Met) (AUG) is at the Nterminus. The final aa added to the chain is the C-terminus. Ribosome Protein Factory Reads the RNA Codons RNA is Copied From DNA (Gene) NUCLEUS GENE DNA UNZIPS mRNA Protein Synthesis amino acid N Protein Chain Folds AA mRNA Transfer RNA (tRNA): Matches mRNA codon with correct amino acid building block MFHMAF2001 Proteins Fold into 3D Structures Proteins live in a watery environment (living organisms!). • Chemical parts that hate water fold on inside of protein. • Chemical parts that love water go to the outside surface of protein. • Surface of the folded protein interacts with proteins, DNA, RNA, etc. Polar “Pocket” C Small Folded Protein Legend N Hates Water Likes Water Hydrophobic “Pocket” Likes Water Likes Water Different Protein Chains Fold to Make Proteins with Different 3D Shapes and Biological Functions Protein #1 Protein #2 Protein #3 Protein #2 Protein #1 Human proteins have 20 different amino acid building blocks Protein #3 Molecular Structures Related to Protein Function in the Cell EF Hand Binds Calcium DNA Intersection: Holliday Junction “Syringe” Channel Basket One Gene-One Protein Archibald Garrod (1902) described alkaptonuria, a hereditary disorder as an “inborn error of metabolism”. Proposed that mutations cause specific biochemical defects. Alkaptonuria defect is dark urine. A DNA Spelling Mistake Can Alter the Protein Chain START ADD ADD ADD ADD ADD ADD ADD STOP ATG TTC AGG CCA AAT TTT GTC GCG UAA GGA ATT Spelling Mistake The DNA “word” TTC is changed to TTT ATG TTT AGG CCA AAT TTT GTC GCG TTC to TTT spelling change causes a different protein building block to be inserted in the second position. That is all it takes. ADD = Codon specifies the amino acid specified by 3-letter “word” ATG/AUG = Codon specifies start and methionine (met) UAA = STOP adding amino acids to protein chain A Mutation is a DNA “Spelling Mistake” Mutant Genes Encode Defective Proteins: (1) WILDTYPE Example: AAA GCT ACC TAT TTT CGA TGG ATA Phe Arg Trp Ile PROTEIN: WT FUNCTION (2) MUTANT AAA GCT ATC TAT TTT CGA TAG ATA Phe Arg Stop UAG NO FUNCTION (1) Normal DNA and amino acid sequence makes a wild-type protein. (2) Mutation in DNA changes Trp to Stop to make a short, mutant protein. Mutations in DNA can be Caused by: • Mistakes made when the DNA is replicated (wrong base inserted) • Ultra violet (UV) light and ionizing radiation (X-rays) damage DNA • Environmental chemical carcinogens can damage DNA • Other factors DNA Technology: The Awesome Skill, I E Alcamo, Harcourt Academic Press, 2001 Misspelled Genes: 3 Possible Outcomes DNA A misspelled gene Cell may not be able to follow damaged instruction Cell does not make the protein OR X X Damaged protein is made Damaged protein may or may not be able to function in the cell. OR Spelling error may be harmless Functional protein made by the cell DNA is Stored in the Nucleus (in Complex Cells) Complex cells have compartments, bacterial cells do not. Minimalist Complex Cell DNA RNA CELL MEMBRANE Controls entry and exit from cell NUCLEUS Cell Control Centercontains DNA, acivation of gene send RNA copies out into the cytoplasm. This is called gene expression. CYTOPLASM The area and material inside the cell, but outside the nucleus and other comparments RIBOSOMES Make proteins from RNA instructions Every Cell Has a Complete Copy of Genome DNA: • Virtually every cell in your body contains its own complete copy of all your DNA • A single, complete copy of an organism’s DNA is called its genome • The genome is a set of instructions, like a master plan, written in a molecular language, using DNA instead of paper and ink • Therefore, each cell in your body has a copy of your genome, which is, in essence, a master plan for making you. But Most of My Cells Don’t Make Melanin-- Right? How BIG is 3.2 Billion DNA Letters? Human Genome Has 3.2 Billion DNA Letters: 3,200,000,000 bp Human Genome 3.2 billion (3.2 x 109) is the same as: • 200 (1000 pages each) New York City telephone books • 3 Gigabyte computer hard drive • a person typing 60 words/minute for 8 hours/day, would take more than 50 years to type the entire human genome sequence • placed end-to-end the DNA in one human cell extends almost 6 feet Genome Facts: NOVA Online Access Excellence Cell to Chromosome to DNA One DNA base-pair How Big are Plant Genomes? Human Genome Has 3.2 Billion DNA Letters: 3200 million bp Plant Genome Maize (Corn) Genome has 2.5 Billion DNA Letters: 2500 million bp Arabidopsis Genome has 125 million bp Rice Genome has 430 million bp Wheat Genome has 16,000 million bp One DNA base-pair Nucleus Executes The Genome Master Plan PLANT CELL: Genome Master Plan is Executed: CHLOROPLAST CELL WALL (1) DNA is copied into RNA code (mRNA) (2) mRNA is transported to the cytoplasm (3) Translate mRNA code into chain of protein building blocks at the ribosome. NUCLEUS DNA mRNA (2) (3) mRNA PROTEIN mRNA NUCLEAR PORE RIBOSOME CYTOPLASM CYTOPLASM CELL MEMBRANE Danny Schnell, BMB (1) DNA is Packaged Into Chromosomes DNA double helix GENE (blue) Several GENES along a length of DNA DNA is coiled around proteins (more on this later) Small region of “unwrapped” chromosome Loosely wrapped DNA in chromosome Tightly wrapped chromosome Adapted from Alberts et al. Molecular Cell Biology How Many Chromosomes Are There? Bacteria usually have one circular chromosome and no nucleus Organisms with nuclei have variable numbers of chromosomes depending on the species: • Mosquito 6 • Chimpanzees 48 • Goldfish 94 How Many Chromosomes Are There? Some plants have few chromosomes like Arabidopsis. Others, like sugarcane, have many. Wheat 42 Rice 24 Arabidopsis 10 Sugarcane +100 Maize 20 Potato 48 Tomato 24 Cabbage 20 Carrot 18 Chromosomes are Dynamic Structures Human Chromosomes CONDENSED EXTENDED Metaphase Chromosome Fruit Fly DNA Discovery Discover DNA: It is Changing OUR Lives… •Human Cloning (imagine dozens of identical siblings!!) •Designer Babies (and all of them “perfect”!?!) •Stem Cells (can we help paralyzed people to walk?) •Gene Therapy (can we fix “broken” genes?) •DNA Fingerprinting (nowhere to hide??!!) Some Questions Students May Have? Most of us know we have DNA and genes… What are genes and how much do they influence us? What do genes and DNA actually do? What is a genome? What is the Human Genome Project? Will the Human Genome Project affect me? Our DNA Story Variations on the Human Theme! People look very different from each other. Yet we all have features in common, 2 arms, 2 legs, one head, one nose, etc. Traits are Inherited Traits are characteristics that vary among individuals. Simple trait: •Eye color: Blue, brown, green •Seed coat color Complex traits: •Blood types: A, B, AB, O •Plant height. •Plant disease resistance. Connection between traits and genes: TRAITS are inherited from parents through GENES! Genes are Responsible for the Traits You Inherit Genes determine: •physical traits and influence personality •biological characteristics such as blood type •level of health risk (heart disease, stroke, alcoholism, Alzheimer’s) •specific genetic diseases (sickle cell, hemophilia, cancer, etc.) •inherited traits that are passed on to your biological children However: the environment always affects the result of genetic inheritance. Example: genes for growth are influenced by nutrition available during child development