* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Download Class Topics - Seneca High School
Molecular cloning wikipedia , lookup
Gel electrophoresis of nucleic acids wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
Cell-penetrating peptide wikipedia , lookup
List of types of proteins wikipedia , lookup
RNA silencing wikipedia , lookup
Eukaryotic transcription wikipedia , lookup
Non-coding DNA wikipedia , lookup
Peptide synthesis wikipedia , lookup
RNA polymerase II holoenzyme wikipedia , lookup
Protein adsorption wikipedia , lookup
Protein (nutrient) wikipedia , lookup
Polyadenylation wikipedia , lookup
Molecular evolution wikipedia , lookup
Transcriptional regulation wikipedia , lookup
Silencer (genetics) wikipedia , lookup
Two-hybrid screening wikipedia , lookup
Protein structure prediction wikipedia , lookup
Bottromycin wikipedia , lookup
Point mutation wikipedia , lookup
Amino acid synthesis wikipedia , lookup
Proteolysis wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
Messenger RNA wikipedia , lookup
Non-coding RNA wikipedia , lookup
Gene expression wikipedia , lookup
Biochemistry wikipedia , lookup
Deoxyribozyme wikipedia , lookup
Expanded genetic code wikipedia , lookup
Nucleic acid analogue wikipedia , lookup
Genetic code wikipedia , lookup
5/23/2017 Title: Biology 3/22/07 Objectives: To learn about how proteins are formed and the central dogma of biology. Class Topics • Hand in W.S. 10.1 before the bell rings • Chapter 10 notes – RNA review – Protein synthesis “Let the farmer forevermore be honored in his calling; for they who labor in the earth are the chosen people of God.” Thomas Jefferson National Agriculture Week 2007 Tuesday, May 23, 2017 8:34 AM Page: 1 5/23/2017 Class Assignments What • • • • Read 208-214 W.S. 10.1 W.S. 10.1 (SS/DL) Chapter 10 Quiz 1 By When 3/22/07 3/22/07 4/2/07 4/4/07 • Due this class period • Due next class period • Due in the future Page: 2 5/23/2017 Grade Sheet Assignments Your score Points possible Your total score Total points possible Chapter 8 Test 99 580 Natural Selection and Allele Frequency lab 10 590 W.S. 9.1 10 600 Chapter 9 Quiz 1 33 633 Tuning in to radioisotopes 10 643 Lab –Doublin’ DNA 10 653 W.S. 9.2 10 663 Percentage grade 2A – p. 157 (5 pts.) Page: 3 5/23/2017 RNA • Ribonucleic Acid • Carries out the instructions coded for by DNA • Differences between RNA and DNA – Ribose is the sugar – Single stranded – Uracil - not thymine bonds with Adenine Page: 4 5/23/2017 Types of RNA • Messenger RNA – mRNA takes DNA “instructions” to ribosomes • Transfer RNA – tRNA brings amino acids to ribosomes • Ribosomal RNA – rRNA makes up a part of each ribosome Page: 5 5/23/2017 • Proteins are manufactured on ribosomes Protein • Proteins are made from Synthesis polypeptides • Polypeptides are made from the 20 amino acids (monomer of protein) – The order and number of amino acids determines the protein’s properties – DNA determines the order of amino acids because it’s the template Page: 6 5/23/2017 Genetic Code • Language of instructions for DNA and RNA • Only 4 letters (ACTG)yet 20 amino acids • Is it read in groups of 1, 2, 3, or 4? • 41 • 42 • 43 • 44 Page: 7 5/23/2017 Page: 8 5/23/2017 Codons • DNA is read in groups of 3 nucleotides - called a codon • Each codon represents an amino acid • AUGGGGUUUCACACUUGGUGA Page: 9 5/23/2017 Protein synthesis (Steps) Transcription • 1. RNA polymerase attaches to DNA • 2. RNA pol. causes DNA to separate into 2 strands (unzip a short length) • 3. DNA makes mRNA (transcription) – mRNA complementary bases attach to DNA • 4. mRNA leaves nucleus - through nuclear pores Page: 10 5/23/2017 Protein synthesis Translation Virtual Cell Animation • 5. mRNA travels down ER to area of ribosomes (or out to free-floating ribosomes) • 6. Ribosome (rRNA and protein) moves along mRNA translating the message • 7. tRNA brings appropriate amino acid to mRNA (at ribosome) - peptide bonds formed between amino acids – Appropriate amino acid determined by codon Page: 11 5/23/2017 Protein synthesis • 8. tRNA leaves amino acid • 9. Protein released • 10. mRNA breaks apart • Central Dogma From: http://esg-www.mit.edu:8001/ esgbio/dogma/dogma.html Page: 12 5/23/2017 Peptide bonds Page: 13