* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download CH. 13 - Weebly
Molecular cloning wikipedia , lookup
Gel electrophoresis wikipedia , lookup
Gel electrophoresis of nucleic acids wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
List of types of proteins wikipedia , lookup
Bottromycin wikipedia , lookup
Promoter (genetics) wikipedia , lookup
Molecular evolution wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
Expanded genetic code wikipedia , lookup
Real-time polymerase chain reaction wikipedia , lookup
Non-coding DNA wikipedia , lookup
RNA interference wikipedia , lookup
Biochemistry wikipedia , lookup
Silencer (genetics) wikipedia , lookup
Messenger RNA wikipedia , lookup
Transcriptional regulation wikipedia , lookup
RNA polymerase II holoenzyme wikipedia , lookup
Polyadenylation wikipedia , lookup
Eukaryotic transcription wikipedia , lookup
Gene expression wikipedia , lookup
Genetic code wikipedia , lookup
RNA silencing wikipedia , lookup
Biosynthesis wikipedia , lookup
Epitranscriptome wikipedia , lookup
Deoxyribozyme wikipedia , lookup
CH. 13 RNA and Protein Synthesis http://www.youtube.com/watch?v=E 5hdETmm-lU&feature=fvsr Vocabulary • RNA: nucleic acid that consists of a long chain of nucleotides • Messenger RNA: carry copies of the instructions • Ribosomal RNA: make up subunits of RNA • Transfer RNA: carries amino acids to ribosome and matches them to the coded mRNA message 13.1: RNA SC.912.L.16.5, LA.910.2.2.3 • RNA: Sugar is Ribose Single-stranded Uracil DNA: Sugar is Deoxyribose Double-stranded Thymine BOTH: Adenine Cytosine Guanine Types of nucleic acids DNA TO RNA ATTCATGCTAGCATGGGCATTACGTACAGTACTACGT UAAGUACGAUCGUACCCGUAAUGCAUGUCAUGAUGCA What’s the RNA strand? A=U C=G *remember uracil NOT thymine!!!!!!! How does the cell make RNA? • In transcription, segments of DNA serve as templates to produce complementary RNA molecules. • Complementary: RNA Polymerase • Enzyme (remember –ase is an enzyme) • Separates the DNA strands and helps assemble nucleotides to DNA template • Template: Promoters • Signals that show the RNA polymerase where to start and stop making RNA • Promoter: Introns vs. Exons Introns: Exons: Cut out and discarded Remaining pieces BOTH: Parts of the DNA template 13.2: Ribosomes and Protein Synthesis SC.912.L16.9, SC.912.N.1.1, SC.912.L16.5 • What is the genetic code, and how is it read? • The genetic code is read three “letters” at a time, so that each “word” is three bases long and corresponds to a single amino acid. Codon • Each 3-letter “word” in mRNA • This is the CODE that must be decoded in order for the protein to be made How to Read Codons • Open book to page 367 in your text book, please see Figure 13-6 MEMORIZE • Start codon: AUG (methionine) • Stop codon: UGA, UAA, UAG
 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
                                             
                                             
                                             
                                             
                                             
                                             
                                             
                                             
                                             
                                             
                                            