* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download Document
Genetic engineering wikipedia , lookup
DNA repair protein XRCC4 wikipedia , lookup
Gel electrophoresis of nucleic acids wikipedia , lookup
Eukaryotic transcription wikipedia , lookup
RNA polymerase II holoenzyme wikipedia , lookup
Transformation (genetics) wikipedia , lookup
Gene regulatory network wikipedia , lookup
Biochemistry wikipedia , lookup
Endogenous retrovirus wikipedia , lookup
Promoter (genetics) wikipedia , lookup
Molecular cloning wikipedia , lookup
Proteolysis wikipedia , lookup
Real-time polymerase chain reaction wikipedia , lookup
Community fingerprinting wikipedia , lookup
DNA supercoil wikipedia , lookup
Non-coding DNA wikipedia , lookup
Genetic code wikipedia , lookup
Two-hybrid screening wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
Messenger RNA wikipedia , lookup
Transcriptional regulation wikipedia , lookup
Nucleic acid analogue wikipedia , lookup
Deoxyribozyme wikipedia , lookup
Point mutation wikipedia , lookup
Silencer (genetics) wikipedia , lookup
Gene expression wikipedia , lookup
Epitranscriptome wikipedia , lookup
Goal 3.01b: Protein Synthesis and Gene Regulation Central Dogma From Gene to Protein Bodies Cells DNA Bodies are made up of cells All cells run on a set of instructions spelled out in DNA neveryetmelted.com i.ivillage.com …to be different heights? What makes it possible for different people… www.learnwell.org … to have different faces? www.saidaonline.com …to have different colored eyes? symonsez.files.wordpress.com Those proteins give us our looks. Makes this protein… Each DNA makes a specific protein. or this protein… cr4.globalspec.com or this protein! gamespot.com Remember… Bases match together A pairs with T A : T C pairs with G C : G weak bonds Now it is time to find out how DNA between bases manages to create so many different join 2 strands kinds of organisms using can separate easily only FIVE pieces of information! What do we know? DNA DNA is the genetic information Proteins proteins run living organisms enzymes all chemical reactions in living organisms are controlled by enzymes (proteins) structure all living organisms are built out of proteins DNA is the instructions for making proteins What else do we know? DNA DNA is in the nucleus want to keep it there = protected Proteins made by a “protein factory” in cytoplasm ribosomes Need to get gene (DNA) information from nucleus to cytoplasm need a messenger! need a copy of DNA mRNA DNA • deoxyribose sugar • nitrogen bases – G, C, A, T • T = thymine –T:A –C:G • double stranded RNA • ribose sugar • nitrogen bases – G, C, A, U • U = uracil –U:A –C:G • single stranded A brief overview of what happens… transcription DNA mRNA protein translation trait nucleus cytoplasm The problem with DNA… DNA (double helix) is too big to go through the pores in the nuclear envelope. RNA (single helix) is small. DNA gives its information to mRNA (messenger RNA) to carry out of the nucleus. TOO BIG! Just right. TRANSCRIPTION • Making mRNA from DNA • DNA strand is the template (pattern) – match bases • U:A • G:C • Enzyme – RNA polymerase mRNA TRANSCRIPTION Making mRNA from DNA T G G T A C A G C T A G T C A T CG T A C CG T U U U U U T G G T A C A G C T A G T C A T CG T A C CG T TRANSCRIPTION • Double stranded DNA unzips T G G T A C A G C T A G T C A T CG T A C CG T TRANSCRIPTION Free-floating nucleotides • Use RNA polymerase • Match free floating RNA bases to DNA bases on one of the DNA strands AG A G C U A G G U U C A C G A U A C RNA A C C polymerase G A U T G G T A C A G C T A G T C A T CG T A C CG T U C TRANSCRIPTION We are transcribing DNA into RNA. U instead of T is matched to A DNA T A C G C A T T T A C G T A G C G G l I I I I I I I I I I I I I I I I I mRNA A U G C G U A A A U G C A U C G C C Transcription Animation http://www.stolaf.edu/people/giannini/flashanimat/molgenetics/transcription.swf What do we know NOW? DNA instructions remain in nucleus mRNA A C C A U G U C G A U C A GU A GC A U G GC A has the instructions for building proteins from DNA Proteins built as chains of amino acids What reads RNA? need a mRNA reader! rRNA in ribosomes From gene to protein CELL cytoplasm Transcription Protein Trait aa aa DNA Translation aa aa aa mRNA aa aa nucleus ribosome A C C A U G U C G A U C A GU A GC A U GGC A rRNA mRNA leaves nucleus through nuclear pores rRNA inside the ribosomes synthesize amino acids to make a protein using instructions on mRNA What do we ALSO know now? mRNA ribosome A C C A U G U C G A U C A G U A G C A U GaG C A has the instructions for building proteins from DNA Proteins a a a a a a ribosome What brings the right amino acid to attach to the protein chain? need an amino acid transporter! tRNA a Peptide bonds built as chains of amino acids linked by a peptide bonds What reads mRNA? a a a From gene to protein cytoplasm Transcription CELL Protein Trait aa aa DNA Translation mRNA nucleus aa aa aa aa ribosome A C C A U G U C G A U C A GU A GC A U GGC A tRNA aa tRNA carries the correct amino acid (based on the mRNAcode) to the ribosome. Let’s build a flow chart! Protein Synthesis TRANSCRIPTION DNA gives mRNA blueprints for making a specific protein. mRNA carries the blueprints out of the nucleus to the cytoplasm and finds a ribosome. TRANSLATION rRNA reads the mRNA inside the ribosome. tRNA brings the correct amino acid to the mRNA. An amino acid chain is built: PROTEIN. Protein give us our traits. BUILD DNA AND DISCOVER GENES! http://learn.genetics.utah.edu/content/begin/dna/ 1. What is DNA? 2. What is a Gene? 3. Build a DNA Molecule. How does tRNA know which amino acid to bring? • When mRNA leaves nucleus it has a blueprint of DNA’s instructions. • mRNA goes to ribosomes in cytoplasm • Ribosomes read the blueprint on mRNA. mRNA ribosome A C C A U G U C G A U C A GU A GC A U G GC A aa aa aa aa aa aa aa aa Using the template… DNA TACGCACATTTACGTACGCGG mRNA AUGCGUGUAAAUGCAUGCGCC ? protein Met Arg Val Asn Ala Cys Ala How can you code for 20 amino acids with only 4 nucleotide bases (A,U,G,C)? mRNA codes for proteins in triplets DNA TACGCACATTTACGTACGCGG Codon = set of 3 bases mRNA ribosome AUGCGUGUAAAUGCAUGCGCC AUGCGUGUAAAUGCAUGCGCC UAC Amino acid ? Anticodon = set of 3 bases Met Arg Val Asn Cys Ala Ala AUGcode is UNIVERSAL! The • Since all living organisms… – use the same DNA – use the same code book – read their genes the same way What amino acids are coded for by these codons? UGA ACU AAC GAG The mRNA code • For ALL life! – Uses only 4 bases for ALL life. (strongest support for a common origin for all life) • Code is redundant – several codons for each amino acid – mutation insurance! Start codon AUG methionine Stop codons UGA, UAA, UAG mRNA DNA TACGCACATTTACGTACGCGG AUGCGUGUAAAUGCAUGCGCC Transcription and Translation Builder http://learn.genetics.utah.edu/content/begin/dna/transcribe/ tRNA tRNA tRNA Ala tRNA Arg Pro Val Leu Met Transcription in Real Time (view as class) http://www.dnalc.org/resources/3d/TranscriptionBasic_withFX.htmll Step Through Translation http://bcs.whfreeman.com/thelifewire/content/chp12/1202003.html You Transcribe and Translate a Gene! http://learn.genetics.utah.edu/content/begin/dna/ 1. Transcribe and Translate a Gene 2. What makes a firefly glow? DNA Translation Real Time and Interactive http://www.dnai.org/a/index.html A Quick Review…. DNA 1. What is this molecule? 3.Whattranscription is this process? 2.What is this molecule? mRNA amino 6.What are theseacids molecules? Can you tell the story? 4.What is this structure? ribosome 5.What is this protein molecule? 7.What is this tRNA 8.What istranslation this process? 29:08 Central Dogma Biologix__Translation_and_Protein_Synthesis molecule? Substitution/Point Mutation = one base is changed and one amino acid is changed. DNA TAC GCA TGG AAT TAC GCA T TGG AAT mRNA AUG CGU ACC UUA AUG CAU ACC UUA Protein Met Arg Thr Leu Met His Thr Leu Insertion Mutation = one base is inserted and everything downstream is changed. DNA TAC CGT GTA ATG TGG GAA AAT T TAC GCA TGG AAT TAT mRNA AUG CGU ACC UUA AUA GCA UAC CUU A Protein Met Arg Thr Leu Ile Ala Tyr Leu http://highered.mcgraw-hill.com/sites/0072556781/student_view0/chapter11/animation_quiz_4.html EXPLAIN DIVERSITY… • Each organism has a unique sequence of DNA. • The DNA sequence determines the order of amino acids in the organism’s proteins. • The order of amino acids determines the shape that the protein made will take. • The shape of the protein determines what it can do. • What the protein does determines everything about the organism. • Gene Regulation determines when a sequence of DNA will be put to use and when it won’t. Gene Regulation…Keeping Control! Every species has its own number of chromosomes in each cell. Notice: More is not always better... Sometimes it’s just more. Organism Number of Chromosomes Cat 32 Chimpanzee 48 Dog 78 Cow 60 Human 46 Horse 64 Pea plant 14 Corn plant 20 Mosquito 6 Honeybee 32 Sugarcane 80 Sand dollar 62 Remember…a section on a chromosome that codes for a specific trait is called a GENE. And… There are lots and lots of genes on each chromosome! The job of a gene is to control the production of proteins. Not every gene is expressed (turned on) at the same time. Gene Regulation = what controls when a gene is expressed and when it is not. In bacteria, genes are in groups called Operons. Example: E. coli that’s in our digestive system helps us break down milk. Baby features (birth – 5 yrs) Teen features (12 yrs – 17 yrs) Adult features (17 yrs – 60 yrs) Child features (5 yrs – 12 yrs) Elderly features (60 yrs – death) Each Operon codes for a specific protein. Start Codon = set of three nucleotide bases where transcription begins. Stop Codon = set of three nucleotide bases where transcription ends. RNA polymerase 3’ 5’ Promoter Sequence = area “upstream” (toward the 5’ end) from the gene where the RNA polymerase attaches. Terminator Sequence = area “downstream” from the gene where the polymerase detaches. Has to have a CAP to start. Are You Lactose Intolerant? Here’s how we metabolize milk… Lac operon http://sumanasinc.com /webcontent/animation s/content/lacoperon.ht ml Can NOT have a Repressor. Beadle and Tatum One gene, one protein. Beadle and Tatum Experiment http://wps.prenhall.com/wps/media/objects/1552/1589869/web_tut/21_04/21_04_01a.swf Gene Therapy: Introduction What is Gene Therapy? Using parts of a gene from a healthy cell to fix a damaged or sick cell. How Gene Therapy Works (Interactive) http://www.edu365.cat/aul anet/comsoc/Lab_bio/sim ulacions/GeneTherapy/Ge neTherapy.htm Don’t hate me Blame it on because I’mmy Any GENES! beautiful… Questions? Assignment: Coach Book L15 img1.chakpak.com