Download Molecular analysis of the structure and expression of the RH... individuals with D--, Dc-, and DCw- gene complexes

Survey
yes no Was this document useful for you?
   Thank you for your participation!

* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project

Document related concepts

DNA vaccination wikipedia , lookup

Zinc finger nuclease wikipedia , lookup

Pathogenomics wikipedia , lookup

Epigenomics wikipedia , lookup

Metagenomics wikipedia , lookup

Primary transcript wikipedia , lookup

Epigenetics in learning and memory wikipedia , lookup

Protein moonlighting wikipedia , lookup

Polycomb Group Proteins and Cancer wikipedia , lookup

Copy-number variation wikipedia , lookup

Genomics wikipedia , lookup

Epigenetics of neurodegenerative diseases wikipedia , lookup

Cell-free fetal DNA wikipedia , lookup

Genetic engineering wikipedia , lookup

Epigenetics of human development wikipedia , lookup

Neuronal ceroid lipofuscinosis wikipedia , lookup

Saethre–Chotzen syndrome wikipedia , lookup

Genome evolution wikipedia , lookup

Genome (book) wikipedia , lookup

History of genetic engineering wikipedia , lookup

Epigenetics of diabetes Type 2 wikipedia , lookup

Gene therapy of the human retina wikipedia , lookup

Point mutation wikipedia , lookup

Gene wikipedia , lookup

Genome editing wikipedia , lookup

Gene therapy wikipedia , lookup

Gene desert wikipedia , lookup

NEDD9 wikipedia , lookup

Nutriepigenomics wikipedia , lookup

Gene expression programming wikipedia , lookup

Vectors in gene therapy wikipedia , lookup

Gene expression profiling wikipedia , lookup

Gene nomenclature wikipedia , lookup

Site-specific recombinase technology wikipedia , lookup

RNA-Seq wikipedia , lookup

Microevolution wikipedia , lookup

Therapeutic gene modulation wikipedia , lookup

Helitron (biology) wikipedia , lookup

Designer baby wikipedia , lookup

Artificial gene synthesis wikipedia , lookup

Transcript
From www.bloodjournal.org by guest on October 15, 2014. For personal use only.
1994 84: 4354-4360
Molecular analysis of the structure and expression of the RH locus in
individuals with D--, Dc-, and DCw- gene complexes
B Cherif-Zahar, V Raynal, AM D'Ambrosio, JP Cartron and Y Colin
Updated information and services can be found at:
http://www.bloodjournal.org/content/84/12/4354.full.html
Articles on similar topics can be found in the following Blood collections
Information about reproducing this article in parts or in its entirety may be found online at:
http://www.bloodjournal.org/site/misc/rights.xhtml#repub_requests
Information about ordering reprints may be found online at:
http://www.bloodjournal.org/site/misc/rights.xhtml#reprints
Information about subscriptions and ASH membership may be found online at:
http://www.bloodjournal.org/site/subscriptions/index.xhtml
Blood (print ISSN 0006-4971, online ISSN 1528-0020), is published weekly by the American
Society of Hematology, 2021 L St, NW, Suite 900, Washington DC 20036.
Copyright 2011 by The American Society of Hematology; all rights reserved.
From www.bloodjournal.org by guest on October 15, 2014. For personal use only.
Molecular Analysis of the Structure and Expression of the RH Locus in
Individuals With D - - , D C - , and DC"- Gene Complexes
By B. Cherif-Zahar, V. Raynal, A.-M. D'Arnbrosio, J. P. Cartron, and Y. Colin
Rh blood group antigens of the D. Clc. and Ele series are
carried by at least three red cell membrane polypeptides
encoded bytwo highly related genes, RHDand RHCE. Homozygous individuals carrying the D--, DC-, and DC*- gene
complexes are characterized by atotal or partial lack of expression ofthe RHCE-encoded antigens. Analysis
of the molecular genetic basisof these rare conditions indicatesthat
complete or partial expression defect of Cc/Ee antigens result from different alterations at the RH locus, but not from
gross deletions. No rearrangement or mutation of the RHCE
gene could be detected in donors homozygous forthe D-complex, suggestingthat thelack ofthe Cc and Ee antigens
might result from a reduced transcriptional activity of the
RHCE gene. The DC- and DC- gene complexes, however,
exhibited an important rearrangement of the RHCE gene.
Instead of the normal RHCE gene, both variants carried a
hybrid RHCE-D-CEgene in which exons4 to 9 (DC- complex)
and 2 (or 3) to 9 (DC" complex) of the RHCE gene, respectively, have been substituted by the equivalent region of
the RHD gene. These gene conversion events provide an
explanation forthe well-described abnormal antigen profiles
associated with the DC- and DC"- complexes, like the increased expression of RhD,the reduced expressionof RhCl
c or RhC", and the absence of RhEle.
0 1994 by The American Society of Hematology.
T
Rh structures present in most individuals (except themselves
and R h n u l l cells) that may be responsible for harmful reactions,10,13.14
HE RH SYSTEM is a major blood group system in
transfusion and clinical medicine, the molecular basis
of which is beginning to be clarified.' It is well established
that the RH locus, located on chromosome lp34-~36,'.~
is
composed of the homologous RHD and RHCE genes in RhDpositive individuals but of the RHCE gene onlyin RhDnegative individuals4 The RHD gene encodes the RhD
protein, and the RHCE gene encodes both the Cc and Ee
proteins, most likely by a process of alternative ~plicing.~
The Rh antigens of the D, C/c, and E/e series, therefore, are
carried by at least three distinct but homologous hydrophobic
proteins that are neither glycosylated nor phosphorylated,
but are major fatty acylated components of the red cell membrane.h-R
Although the molecular genetic basis of the RhC, Rhc,
RhE, and Rhe antigens have been clarified recently:very
little is known about the defect(s) responsible for the lack
of C/c and/or We antigen expression in gene complexes
defined as D",
DC-, or D C - . " Homozygous individuals
for these rare gene complexes all exhibit a larger amount of
RhD antigen than that expressed by common RhD-positive
individuals. Moreover, in DC- and D C - complexes, the
RhC/c and RhC" antigens are often weak, with variations
from one family to another. The RhE/e antigens are absent,
although a weak form of Rhce and occasionally of Rhe
antigens have been associated with some DC- complexes.lC''
After immunization by transfusion or pregnancy, these donors develop complex antibodies directed against ill-defined
From theUnite'INSERM U76, Institut National de Transfusion
Sanguine, Paris, France.
Submitted April 12, 1994; accepted August 23, 1994.
Supported in part byNATO Grant No. 0556/88and by the Caisse
Nationale d'Assurance Maladie des Travailleurs Salaritk
Address reprint requests to Baya Cherif-Zuhar, PhD, Unite' INSERM U76, Institut National de Transfusion Sanguine, 6 rue Alexandre Cabanel, 75015 Paris, France.
The publication costsof this article were defrayedin part by page
chargepayment. This article must therefore behereby marked
"advertisement" in accordance with I8 U.S.C. section 1734 solely to
indicate this fact.
0 1994 by The American Society of Hematology.
0006-4971/94/8412-00I 1$3.00/0
4354
To elucidate which gene alteration may explain these gene
complexes, unrelated individuals homozygous for the D - -,
DC-, and DC'" haplotypes were investigated by Southern
blot analysis with probes specific for each RH gene and by
nucleotide sequencing of the Rh transcripts isolated from
blood cells.
MATERIALS AND METHODS
Materials. Restriction enzymes, bacterial alkaline phosphatase,
andpUC vectors were from Appligene (Strasbourg, France). T4
polynucleotide kinase, DNA polymerase I Klenow fragment, and
radiolabeled nucleotides were from Amersham (Bucks, UK). Avian
myeloblastosis virus (AMV) reverse transcriptase was obtained from
Promega Biotech (Madison, WI), and Thermus aquaticus polymerase (Taq polymerase) was from Perkin-Elmer-Cetus (Nonvalk, CT).
The random priming labeling kit was from Boehringer (Mannheim,
Germany), andthe sequencing kitwas from Pharmacia (Uppsala,
Sweden).
Blood samples. Blood samples from Rh-deficient patients were
collected on EDTA. Blood samples from rare homozygous Dc(Bol.), D-- (Gou.), and D C - (Glo) donors, were provided by Drs
Majorel-Rivibre (Centre de Transfusion Sanguine [CTS], Valence,
France), J.P. Saleun (CTS, Brest, France), and A. Chung (Ottawa,
Canada), respectively.
Genomic DNA analysis. Human DNA extracted from peripheral
leukocytes was digested with restriction enzymes (10 Ulpg DNA),
resolved by electrophoresis in 0.8% agarose gel, and transferred
onto Zeta probe GT nylon membrane (Biorad, Richmond, VA), as
de~cribed.'~
DNA probes used for hybridizations were: (1) the full
length RhIXb cDNA encoding the Cc/Ee proteins"; and (2) amplified sequences specific of exons 1,4, S, 6, 7, 8, and exons 9 and 10
of the RHCE gene." Hybridization with DNA probes (lo6 cpdmL)
was performed for 20 hours at 65°C in 7% (wt/vol) sodium dodecyl
sulfate (SDS), 500 mmol/L NaHP04, 1 mmoW EDTA. Final washes
were performed at 65°C for 45 minutes in 5% SDS, 40 mmol/L
NaHP04, 1 mmol/L EDTAand for 30 minutes in 1% SDS, 40
mmol/L NaHP04, 1 mmol/L EDTA.
Reverse transcription coupled withpolymerase chain reaction
ampliJcation (RT-PCR). Total RNAs were extracted by the acidphenol-guanidinium method'* from 5 mL of peripheral blood. RNA
(0.5 pg) was incubated for 40 minutes at 42°C in a reaction mixture
(SO pL) containing 100 mmoVL Tris (pH 8.3), 140 mmol/L KCl,
Blood, Vol84, No 12 (December 15). 1994: pp 4354-4360
From www.bloodjournal.org by guest on October 15, 2014. For personal use only.
ANALYSIS OF D",
DC-,
4355
AND DC"" GENE COMPLEXES
Table 1. Reactivity of D", DC-, and D C - Red Cells
With Rh Alloantibodies
Reactivity With Antibodies Against
Red Cells
D
C
C"
c
E
e
-
-
-
-
-
-
-
(+)
((+))
(+)
-
-
+
-
+
+
-
-
-
+
Variants
D--ID-(Gou)
Dc-/Dc- (Bol)
DC"-/DC"- (Glo)
Controls
DCCee
ddccee
+
+
-
-
-
-c
+
+
Abbreviations: +, enhanced reactivity; (+l, weak reactivity; ((+)),
very weak reactivity.
A weak Rhe or Rhce reactivity may be occasionally observed.
10 mmol/L MgCl?, 30 mmol/L &mercaptoethanol, 1 mmol/L of
each deoxynucleoside triphosphate (dNTP), 40 U of ribonuclease
inhibitor (RNasine). and10 U of AMV reverse transcriptase. The
cDNA products were then subjected to PCR in 50 mmol/L KCI, 10
mmol/L Tris (pH 8.3). 0.01 ?hgelatin, 0.2 mmol/L of the four dNTPs,
50 pmolof each primer, and2.5 U of Tu9 polymerase. Primers
based on the Rh cDNAs were as follows (+ 1 representing A of the
initiation ATG codon): J: nucleotides (nt) -19 to -2 and K:nt
1350 to 1330, corresponding to the 5' and 3' untranslated regions,
respectively, which are common to both RHD and RHCE genes; L:
nt 801 to 784; M: nt 498 to 5 15; and N: nt 1382 to 1361, corresponding to CE-specific sequences. PCR amplifications (30 cycles) were
performed under the following conditions: l-minute denaturation at
94°C. l-minute primer annealing at 55°C. and 2-minute extension
at 72°C. Amplification products were analyzed by agarose gel electrophoresis and hybridization with D or CE oligonucleotide probes.
Relevant PCR fragments were purified after agarose gels electrophoresis, phosphorylated with polynucleotide kinase, and subcloned in
pUC 18 vector.
DNA sequencing. Inserts from recombinant pUC18 vectors were
sequenced onboth strands using the dideoxy chain termination
method."
RESULTS
The reaction of red cell samples from the individuals homozygous for the D--, DC-, and DC'" gene complexes
with specific anti-Rh antibodies are summarized in Table 1.
The results show the increased amount of RhD, the weakest
reactivity of Clc and C", and the absence of expression of
We antigens as compared with controls.
Southern blot analvsis of the RH locus in the DC- and
D-- gene complexes. Genomic DNA from homozygous
D - - and DC- individuals was subjected to Southern blot
analysis withRh-specificprobes.DNA
from Rh-positive
(DCCee)and Rh-negative (ddccee)donors were used as controls.
The zygosity for the RHD gene in the D - - and Dcsamples was first investigated by Southern blot analysis of
Hind111 digests with an exon-l-specific probe that hybridized to both the RHD and RHCE genes."' As shown in Fig
1, the D and CE fragments of 2.2 and 2.0 kb, respectively,
were detected with the same intensity in the homozygous
DD control sample (peak ratio, 0.85) and in the D - - (peak
ratio, 0.81) and DC- (peak ratio, 1 ) samples, whereas a 1:2
gene dosage effect (peak ratio, 0.60) was observed in the
control Dd DNA. These results indicated that the D-- and
DC- haplotypes under investigation each carried one copy
of both RH genes. The BamHI hybridization pattern obtained
with the RhIXb cDNA probe'6 was next examined (Fig 2A).
As the coding regions of the two RH genes present in Rhpositive genomes are 96% homologous,"." restriction fragments originating from both RHCE and RHD genes (23, 19,
7.3,5. I , 4.0, and 2.1 kb) were deleted with the RhIXb cDNA
probe. In the Rh-negative DNA,which carries onlythe
RHCE gene: the D-specific bands at 19 and
4.0 kb were
missing (Fig 2A).
The hybridization pattern of D - - and Rh-positive
(DCCee) DNAs did not differ either after BamHI digestion
(Fig 2A) or after EcoRI, Pst I, and Hind111 cleavage (not
shown). These results suggested thatthereisno
obvious
alteration like a gross deletion of the structural RH genes
organization associated withthe D - - gene complex. In
contrast, the DC- DNA showed an altered hybridization
pattern with respect to the Rh-positive control. Indeed, the
two comigrating fragments of 23 kb that carry exons 7-8
and exons 9- 10 of the RHCE gene17 were missing, and the
5.1 kb was understochiometric (Fig 2A). Concurrently, two
unusual bands of 21 kb (better shown in Fig 2B) and 4.3
kb, respectively, were detected. To better characterize these
fragments, BamHI digests werehybridizedwith
several
exon-specific probes designed from analysis of RHCE gene
~tructure.'~
Comparison of the different patterns obtained
with the DCCee, ddccee, and DC- samples indicatedthat
only the RHCE gene was altered in the DC- gene complex,
since the 23 and 5.1 kb CE-specific bands detected by the
exon 7, 8, 9, and I O and exon 4, 5, 6 probes, respectively.
were missing in this variant (Fig 2B). In addition, the polymorphic bands of 4.3 and 21 kbfoundonly in the Dc-
Ueriantt
Controls
Hind1I I
Fig 1. Determination of the zygosity for the RHD gene by Southern blot analysis. Genomic DNAfrom donors with the indicated genotype for the RHD gene and from homozygous D-- and DC- individuals was digested with the Hindlll restriction enzyme and hybridized
with an exon 1 probe. Gene dosage effect was estimated by determination of t h e relative intensity of 2.2/2.0k b fragments corresponding
to the RHD and RHCE genes, respectively, following densitometry
analysis of the autoradiogram (see Results).
From www.bloodjournal.org by guest on October 15, 2014. For personal use only.
CHERIF-ZAHAR ET AL
4356
B
EHON
PROBE
-
kb
0
0
n
u
-
kb
23 -
19 -
23,
e21kb
c2lkb
19,
7.3 -
R'
5.1 4.0
2.1
-
-4.3kb
- =
-
-
BamHl
19-
-
t
'<S
u
Fig 2. Southern blot analysis ofthe RH locusfrom
individuals with D-- and DC- phenotypes. DNA
from Rh-positive (DCCeel and Rh-negative (ddccee)
donors was used as a control.Samples were diaested with BarnHl restriction enzyme and hybridized on Southern blot with the full length RhlXb
cDNA probe (A) or with Rhprobesspecificof
the
exons indicated in boxes (B). Asingle probe was
used for exons 9 and 10 (9
10). Arrows indicate
polymorphic bands (4.3 and 21 kb) in the DC- DNA.
-
. .
5*14.0-
4
m- 4.3kb
+
BamHl
sample corresponded to the genomic region encompassing
exons 4-6 and exons 9-10, respectively. The absence of the
23-kb fragment after hybridization with exon 7 or exon 8
suggested either a deletion of the relevant regions of the
RHCE gene in the DC- gene complex or the presence of an
unusual band comigrating with the 19 kb D-specific fragment. The exon-specific probes used in these experiments
also revealed abnormal bands in the EcoRI, HindIII, Taq I,
and Pst I restriction patterns of the DC- sample (not shown).
This strongly suggested that the DC- gene complex was
associated with an important rearrangement of the RHCE
gene.
PCR amplijcation and sequence analysisof Rh transcripts
from DC- and D-- genecomplexes.
Total RNAs extracted from peripheral blood of DC-, D--, and DCCee
donors were copied to cDNAs, then amplified by PCR. Amplifications were performed between oligonucleotides J and
K (see Materials and Methods), which are common to the
RHCE and RHD genes. Three amplification products (1.36,
1.22, and 1.06 kb) identified under UV light were found in
all samples (Fig 3). In addition, minor bands at 0.96 and
0.90 kb could be detected by hybridization with cDNA
probes. The PCR fragments were characterized either by
nucleotide sequencing andlor by Southern blot analysis with
oligonucleotide probes specific for all exons of RHCE or
RHD genes. The results are summarized in Table 2.
In the ddccee sample, PCR products corresponding to the
full length RhCE transcript (1.36 kb), as well as to several
isoforms (1.22, 0.96, and 0.90 kb) described previously:
were found, but as expected, no RhD transcript could be
detected. In the DCCee sample, the predominant transcripts
identifiedincluded full length RhD and RhCE species of
1.36 kb. Isoforms of both the RhD (1.22 and 1.06 kb) and
RhCE (1.22,0.96, and 0.90kb) messengers were also present
as minor species. When the D - - sample was examined,
only the RHD gene transcripts were identified by hybridization studies (Fig 3 and Table 2), although the overlapping
region of RhCE transcripts could be amplified fromthe reticulocyte preparation with two pairs of CE-specific primers
(J-L and M-N, see Materials and Methods), but not as full
length messengers (perhaps explainable by competition between D and CE templates at the first steps of the PCR
reaction). In the DC- sample, RhD transcripts-like those
identified in the DCCee and D - - samples-werefound
(Fig 3 and Table 2). In addition, hydrid RhCE-D-CE transcript species were present, the structure of which wasestablished both by sequencing and hybridization with exon-specific probes. The full length RhCE-D-CE hybrid transcript
was composed of exons 1 to 3 from the RHCE gene, followed
Q)
Q)
Q)
kb
U
I
I
U
U
I
x 0 0 0
Q)
U
U
U
kb
Fig 3. RT-PCR analysis of Rh expression in homozygous DC- and
D-- donors. PCR products amplified from DCCee, DC-, D",
and
ddccee samples were resolved on 0.8% agarose gel and visualized
under UV light after staining with ethidium bromide. Sizes of the
amplification products are indicated. DNA size marker (M) is a 100bp ladder. Fragments
amplifiedfrom ddcceecDNAswere analyzed on
a distinct gel. Asterisks indicate nonspecific amplification products.
From www.bloodjournal.org by guest on October 15, 2014. For personal use only.
ANALYSIS OF D",
4357
Table 2. Rh Gene Transcripts Identified in Reticulocytes FromRh Variants
Size (kb)
E
67)
DC-, AND D P - GENECOMPLEXES
D(67),
DCCee
Full length*
CE1.36
lsoforms
CE-D-CE(b7)
1.22
1.06
0.96
0.90
ddccee
D"
D,
D(67).
5,
D(67)
D(67-9)
CE(64,
8)
CE(64-6)
CE-D-CE
D
Dc-
D,
CE(67)
D(67-9)
D(b7-9), CE-D-CE(67-9)
CE(64, 5, 8)
CE(64-6)
Abbreviation: 6, exon deletion.
* 10-exon structure.
by exons 4 to 9 from the RHD gene, and terminated with
exon 10 from the RHCE gene. Moreover, isoforms of the
hybrid gene were also identified by sequencing analysis (Table 2 ) .
Among the different cDNAs sequenced, some were found
to contain a 44-bp insertion (GGGCTGGGAAGTCTGCATGCTGTCTATAAATCCAGAACCAGAAG) between nucleotides 148and149.
This position corresponds to the
boundary junction of exons 1 and 2.'7As hybridization experiments indicated that this 44-bp sequence was located
within intron 1 (not shown), these cDNAs were supposed to
derive from aberrantly spliced mRNA. This insertion was
identified in both RhD and RhCE transcripts derived from
all phenotypes under study.
Restriction analysis of the RH locus from the DC"- gene
complex. As no transcripts were available, each exon of
the RH genes was examined to determine its CE or D origin,
either after amplification between allele-specific primers
(PCR-ASP) or after amplification between common primers
followed by restriction length polymorphism (PCR-RFLP)
or sequence analysis. Genomic DNA from DCCee, ddccee
donors and the DC- variant were used as control.
In PCR-ASP experiments, exon 9 sequence specific of the
RHCE gene was amplified from the DCCee and ddccee
DNAs but not from the DC- and the DC" samples, whereas
exon 10 specific of the RHCE gene was amplified inall
samples (not shown).
Cloning and sequence analysis of the PCR-amplified exons 1, 2, and 3 from the DC'"- DNA indicated that the exon
3 products carried only the D specific sequences, whereas
exon 1 products contained both the D and C specific nucleotides at position 48.' The C-specific exon 1 contained in
addition an A
G nucleotide substitution at position 122
resulting in an amino acid change (Glu -+ Arg) at position
41 of the RHCE encoded protein. The D or C specificity of
exon 2 could not be determined, as the RHD gene and the
RHC allele share the same sequence in this coding region.'
PCR-RFLP experiments were performed on exons 4 to 7.
PCR amplification of exons 4, 5, 6, and 7 generated fragments of 149, 166, 191, and 134 bp, respectively. In
agreement with the nucleotide polymorphisms between the
RHD and RHCE specific coding s e q u e n ~ e s , ' ~ ,the
~ " ~149
~
(exon 4) and 166 (exon 5) bp fragments in the Rh-positive
sample (DCCee) were cleaved by the restriction enzymes
Avu I and Tuq I, respectively, when originating from the
+
RHD gene but were not cleaved when issued from the RHCE
gene (Table 3). The 191-bp fragment (exon 6) generated
three Rsu I restriction fragments when originated from the
RHD gene but only two fragments when issued from the
RHCE gene. The 134-bp fragment (exon 7), on the contrary,
was cleaved by Hph I only when originating from the RHCE
but not from the RHD gene (Table 3). In the Rh-negative
sample (ddccee),cleavage of the PCR products was in accordance with the presence of the RHCE gene only (Table 3).
Similar PCR-RFLP analysis performed with the D C " and
DC- samples indicated that, in all restriction patterns, the
fragments corresponding to the RHCE gene were missing
(Table 3).
DISCUSSION
The structure and organization of the RH locus from rare
individuals homozygous for the D - -, DC-, and D C " gene
complexes were examined. The results established that the
lack of the Cc and/or Ee antigens at the surface of D - and DC- or D C - red cells, respectively, originated from
different alterations of the RHCE gene. As expected, however, the RHD gene structure was found to be normal for
the three variants. During these studies, a main transcript
containing the 10 exons of the RHD gene was identified as
well as two previously unreported isoforms lacking exon 7
and exons 7 to 9, respectively. The putative RhD proteins
encoded by the shortened transcripts have not yet been characterized.
Southern blot analysis of genomic DNA from the Dcsample showed an important rearrangement of the RHCE
gene. This was confirmed by transcript sequencing analysis,
which indicated that the DC- locus included a normal RHD
gene and a hybrid RHCE-D-CE gene composed of exons 1
to 3 from the RHCE gene, followed by exons 4 to 9 from
the RHD gene and exon 10 from the RHCE gene. A similar
hybrid RHCE-D-CE gene structure most likely also occurred
at the D C " locus, as it has been shown that sequences
specific of exons 3 to 9 of the RHCE gene are absent from
this gene complex. We could not determine whether exons
2 and 8 of this hybrid gene originated from an RHC or RHD
allele because these exon sequences are identical between
the two genes. The hybrid genes may have arisen either by
double crossing-over or by homologous recombination, via
the mechanism of gene conversion, involving a segmental
replacement of DNA encompassing exon 4 to 9 or 2 (or 3)
size)
From www.bloodjournal.org by guest on October 15, 2014. For personal use only.
4358
ET AL
CHERIF-ZAHAR
Table 3. RHD/RCE Typing of Exons 4 to 7 by PCR-RFLP
Size (bp) of Gene Fragments From RHD and RHCE Genes
DC- Complex
Rh-Negative
Rh-positive
Exon
E4 (149 bp)
Ava I
E5 (166 bp)
Taq I
E6 (191 bp*)
Rsa I
45
E7 (134 bp)
x
Hph I
D
CE
CE
D
88
61
106
60
85
61
45
134
149
149
166
166
146
146
59
56
19
45
59
56
19
88
61
106
60
85
61
45
134
DC*- Complex
CE
D
CE
88
61
106
60
85
61
45
134
The 191-bp fragment includes 50 nucleotides from intron 7 in order to generate distinguishable restriction fragments.
to 9 from an RHD (donor) gene to an RHCE (acceptor)
gene in the DC- and D C - complexes, respectively (Fig 4).
Homologous recombination involving RH genes was previously reported for the D"' phenotype (type 11) where a
reverse conversion scheme producing an RHD-CE-D hybrid
gene (in which exons 4 to 6 of the RHD gene have been
replaced by exons 4 to 6 from the RHCE gene) was associated with the lack of epitopes Dl, D2, D5, D6/7 and D8 of
the major D antigen.'4
The hybrid protein encoded by the DC- gene complex
includes amino acids 163 to 417 (62% of the polypeptide
sequence) specific of the D protein (as the coding region of
exon 10 from the RHCE and RHD genes are identical). The
hybrid protein encoded by the D C - gene complex would
contain even more D-specific sequences (73%, from amino
acid 113 to 417). It is expected that these unusual proteins
should express several (if not all) of the nine epitopes presently known to compose the D antigen.'"'' These structural
features provide a clear explanation for the serologic properties determined by the DC- and D C - complexes, which
are characterized by a greater than normal amount of D, a
reduced expression of c (or Cw),a weak Rhce (Rh6) reactivity in many instances (DC- only) and total absence of Ee.'"
Indeed, in addition to the normal D protein, these complexes
produce a hybrid protein carrying both D and Cc epitopes,
but the C/c reactivity is lower than normal.
The C/c polymorphism is predominantly associated with
a SerPro substitution at the exofacial position 103 (encoded
by exon 2 ) of the RHCE encoded proteins (Mouro et a1' and
Salvignol et al, manuscript in preparation). However, the
presence of the CE-specific amino acids encoded by exons
1 and 2 of the RHCE-D-CE hybrid genes in the DC- and
DC'" complexes cannot restore full expression of c or C",
presumably because these antigens are conformation-dependent structures. Most likely, they need an appropriate configuration which is optimally found only in the native (wild
type) RHCE gene product. This may also explain why the
D protein, which exhibits a serine at position 103, is not
reactive with anti-C antibodies.'
The E/e polymorphism is associated with a Pro226Ala
(E + e) substitution encoded by exon 5 of the RHCE gene.'
This epitope is conformation-dependent since the RhD protein, which carries an Ala residue at position 226, is unreactive with anti-e antibodies.' The RHCE-D-CE hybrid genes
lack exon 5 and cannot obviously produce proteins with E/
e antigenicity (Fig 4B). The weak Rhce specificity frequently
detected in individuals carrying the DC- complex, however,
may result from some interaction between the Rhc-specific
region of the hybrid protein and the Ala residue present in
the D-specific region of the molecule (Fig 4B).
The CE-D-CE hybrid protein schematically drawn in Fig
4B is characterized by new junctions between CE- and Dspecific amino acids within the third extracellular loops. It
is expected that these junctions might create new Rh epitopes
recognized by as yet unidentified antibodies, which may further characterized the DC- gene complex.
Among the different DC- and D C - cases reported, only
one DC- variant exhibited neither an increased RhD reactivity nor a reduction of Rhc expression.'x It is possible that
this variant may result from a point mutation or from a
gene conversion event involving only few nucleotides. The
absence of Cc and Ee antigen expression in the D - - variant
resulted neither from a deletion or a rearrangement of the
RHCE gene nor from point mutations within the coding
region. Experimental evidence indicated that the D transcripts were normally present, whereas the CE transcripts
were only poorly represented in D - - reticulocytes. This is
in agreement with recent immunochemical studies performed
with anti-peptide antibodies indicating that Cc- and Ee-related proteins are not detectable onred cell preparations
from D - - individuak2'
It has been postulated that the Rh antigen structure is
a large membrane complex containing RhandRh-related
proteins as well as other unrelated glycoproteins. Rhproteins, and/or some other unidentified component(s) are required for the correct transport of the Rh complex to the
cell membrane.' Therefore, the lack of the RHCE-encoded
proteins, by releasing sites within the Rh complex, would
be directly associated with the overexpression of the D antigens at the red cell membrane of the D - - variant. This
From www.bloodjournal.org by guest on October 15, 2014. For personal use only.
ANALYSIS OF D",
DC-, AND
D P - GENE COMPLEXES
D gene
C€ gene
exons 4-9
D
m
-<-l
4359
RHD gene and of a silent RHCE gene as also found in the
Rhnullamorph chromosome.However,
it is notknown
whether the downregulation mechanisms of this gene in both
conditions are identical. Further study should determine
whether the lack of expression of the Cc and Ee antigens on
D - - red cells might result from mRNA instability or to
a mutation within transcription cis-acting elements located
outside the proximal promoter region.
ACKNOWLEDGMENT
C€-D-C€ gene
D
+
We thank Drs Majorel-Rivikre (CTS, Valence, France), J.P. Saleun (CTS, Brest, France), and A. Chung (Ottawa, Canada) for the
generous gift of Rh-deficient samples.
REFERENCES
1
Hybrid CE-D-CE Protein of the DC- complex
[162/1631
Pro
/
.Ala 226
Fig 4. Model of gene conversion and predicted membrane topolof a homologous
ogy forDc- gene complex.(A) A directional transfer
DNA segment encompassing exons 4 to 9 (indicated by the double
arrows) from the RHD gene (donor) to the RHCE gene (recipient)
generated the hybrid RffCf-D-C€ gene structureof the DC- complex.
A similar directional transfer of exons 2 (or 3) to 9 generated the
D C - complex (not shown). While the recipient gene (either from
an Rh-positive or an Rh-negative chromosome) is converted into a
recombinant. The donor gene restores
its native structure bya repair
synthwis. (B) Predicted membrane topology of the De- gene-encoded protein. The bold line represents the polypeptide sequence
specific of the D protein. Open circles refer to amino acid substiiutions that diatinguishDfrom CE proteins. Closed cirde indicates
amino acids associatedwith the C/c (103 = Ser/Pro) polymorphisms.
Alanine (Ala) at position 226 of the D protein is indicated. Arrows
indicate the new junction sites of the hybrid protein.
hypothesis suggests, as demonstrated for glycophorin Clprotein 4.1 as~ociation,~'
that the Rh polypeptides may be synthesized in excess and their membrane content regulated by
that of the other members of the complex.
When the promoter sequence of the RHCE gene from the
D - - locus was compared with the common RHCE gene
promoter," no mutation was found after sequencing 600 bp
upstream of the transcription initiation site. Similarly, the
proximal promoter of the RHCE gene carried by an Rh,,,,
amorph complex was not different.20Accordingly, the RH
locus of D - - individuals might be composed of a normal
1. Cartron JP, Agre P Rh blood group antigens: Protein and gene
structure. Semin Hematol 30:193, 1993
2. MarshWL, Chaganti RSK, Gardner FG, Mayer K, Nowell
PC, German J: Mapping human autosomes: Evidence supporting
assignment of Rhesus to the short arm of chromosome no 1. Science
184:966, 1974
3. ChCrif-Zahar B, Mattbi MG, Le Van Kim C, Bailly P, Cartron
JP, Colin Y: Localization of the human Rh blood group gene structure to chromosome lp34.3-lp36.1 region by in situ hybridization.
Hum Genet 86:398, 1991
4. Colin Y, Chbrif-Zahar B, Le Van KimC, Raynal V, Van Huffel
V, Cartron JP: Genetic basis of the RhD-positive and RhD-negative
blood group polymorphism. Blood 78:2747, 1991
5. Le Van Kim C, ChCrif-Zahar B, Raynal V, Lopez M, Cartron
JP, Colin Y: Multiple Rh mRNAs isoforms are produced by alternative splicing and poly(A) site choice. Blood 80:1074, 1992
6. Gahmberg CG: Molecular characterization of the human redcell Rho(D) antigen. EMBO J 2:223, 1983
7. De Vetten MP, Agre P: The Rh polypeptide is a major fatty
acid acylated erythrocyte membrane protein. Biol
J
Chem
263:18193, 1988
8. Blanchard D, Bloy C, Hermand P, Cartron JP, Saboori A,
Smith BL, Agre P: Two-dimensional iodopeptide mapping demonstrates erythrocyte Rh D, c, and E polypeptides are structurally homologous but nonidentical. Blood 72:1424, 1988
9. Mouro I, Colin Y, ChCrif-Zahar B, Cartron JP, Le VanKim
C: Molecular genetic basis of the human Rhesus blood group system.
Nature Genet 5:62, 1993
10. Race RR, Sanger R: Blood Groups in Man. Oxford, UK,
Blackwell Scientific, 1975
11. Tessel JA, Wilkinson SL, Hines SR, Issitt P Differences in
the products of 'DC-' genes. Transfusion 20:632, 1980
12. Moores P, Vaaja U, Smart E: D-- and DC- gene complexes
in the coloureds and blacks of Natal and the Eastern Cape and blood
group phenotype and gene frequency studies in the Natal coloured
population. Hum Hered 41:295, 1991
13. Gunson HH, Donohue WL: Multiple examples of the blood
genotype C"D-/C"D- in a Canadian family. Vox Sang 2:320, 1957
14. Olafsdottir S, Jensson 0, Thordarson G, Sigurdardottir S: An
unusual rhesus haplotype, -D-, in Iceland. Forensic
Sci Int 22:183, 1983
15. Southern E: Detection of specific sequences among DNA
fragments separated by gel electrophoresis. J Mol Biol98:503, 1975
16. Chbrif-Zahar B, Bloy C, Le Van Kim C, Blanchard D, Bailly
P, Hermand P, Salmon C, Cartron JP, Colin Y: Molecular cloning
and protein structure of a human blood group Rh polypeptide. Proc
Natl Acad Sci USA 87:6243, 1990
17. ChCrif-Zahar B, Le Van Kim C, Rouillac C, Raynal V, Car-
From www.bloodjournal.org by guest on October 15, 2014. For personal use only.
4360
tron JP, Colin Y: Organization of the gene (RHCE) encoding the
humanblood group RhCcEe antigens and characterization of the
promotor region. Genomics 19:68, 1994
18. Izraeli S, Pfleiderer C, Lion T: Detection of gene expression
by PCR amplification of RNA derived from frozen heparinized
whole blood. Nucleic Acids Res 19:6051, 1991
19. Sanger F, Nicklen S , Coulson AR:DNA sequencing with
chain-terminating inhibitors. Proc Natl Acad Sci USA745463, 1977
20. ChCrif-Zahar B, Raynal V, Le Van Kim C, D'Ambrosio AM,
Bailly P, Cartron JP, Colin Y: Structure and expression of the RH
locus in the Rh-deficiency syndrome. Blood 82:656, 1993
2 1. Le Van Kim C, Mouro I, Chtrif-Zahar B, Raynal V, Chemer
C, Cartron JP, Colin Y : Molecular cloning and primary structure of
the human blood group RhD polypeptide. Proc Natl Acad Sci USA
89: 10925, 1992
22. Arce MA, Scott Thompson E, Wagner S, Coyne KE, Ferdman
BA, Lublin DM: Molecular cloning of RhD cDNA derived from a
gene present in RhD-positive, butnot RhD-negative, individuals.
Blood 82:65 I , 1993
23. Avent ND, Ridgwell K, Tanner MJA, Anstee DJ: cDNA cloning of a 30 kDa erythrocyte membrane protein associated with Rh
(Rhesus)-blood-group-antigen expression. Biochem J 271:82 I , 1990
CHERIF-ZAHAR ET AL
24. Mouro I, Le VanKim C, Rouillac C.van RhenenDJ,Le
Pennec PY, Cartron JP, Colin Y: Rearrangements of the bloodgroup
RhD gene associated with the D"' category phenotype. Blood
83: 1 129, 1994
25. Lomas C , Tippett P, Thompson KM, Melamed MD. HughesJones NC: Demonstration of seven epitopes on the Rh antigen D
usinghuman monoclonal anti-D antibodies and red cells from D
categories. Vox Sang 57:261, 1989
26. Lomas C, McColl K, Tippett P: Further complexities of the
Rh antigen D disclosed by testing category D" cells with monoclonal
anti-D. Transfusion Med 3:67, 1993
27. Tippett P: Serologically defined Rh determinants. J. Immunogenet 17:247,1990
28. Leyshon WC: The Rh gene complex CD- segregating in a
negro family. Vox Sang 13:354, 1967
29. Hermand P, Mouro I, Huet M, Bloy C, Suyama K , Golstein
J, Cartron JP, Bailly P immunochemical characterization of Rh
proteins with antibodies raised against synthetic peptides. Blood
82:669, 1993
30. Reid ME, Takakuwa Y, Conboy J, Tchernia G, Mohandas N:
Glycophorin C content of human erythrocyte membrane is regulated
by protein 4.1. Blood 75:2229, 1990