Download Molecular cloning, expression, and bioactivity of dove B lymphocyte

Veterinary Immunology and Immunopathology 128 (2009) 374–380
Contents lists available at ScienceDirect
Veterinary Immunology and Immunopathology
journal homepage: www.elsevier.com/locate/vetimm
Research paper
Molecular cloning, expression, and bioactivity of dove B lymphocyte
stimulator (doBAFF)
Wuguang Lu a,b, Peng Cao b,*, Xueting Cai b, Jiemiao Yu b, Chunping Hu b,
Meng Cao b, Shuangquan Zhang a,*
a
b
Jiangsu Province Key Laboratory for Molecular and Medical Biotechnology, Life Sciences College, Nanjing Normal University, Nanjing, 210097, Jiangsu, China
Laboratory of Cellular and Molecular Biology, Jiangsu Province Institute of Traditional Chinese Medicine, Nanjing, 210028, Jiangsu, China
A R T I C L E I N F O
A B S T R A C T
Article history:
Received 25 July 2008
Accepted 19 November 2008
B cell activating factor (BAFF) belonging to the tumor necrosis factor (TNF) family is a novel
member of the tumor necrosis factor ligand family and plays an important role in B
lymphocyte maturation and survival. cDNA of dove B lymphocyte stimulator (doBAFF) was
amplified from total RNA of dove spleen by RT-PCR (reverse transcription PCR). The open
reading frame of doBAFF consists 867 bases encoding a protein of 288 amino acids.
Sequence comparison indicated the amino acid sequence of doBAFF showed high identity
to hBAFF (50.66%) and cBAFF (91.32%). The result of RT-PCR showed that doBAFF was
highly expressed in the spleen and bursa of fabricius. To enhance the soluble expression of
doBAFF in Escherichia coli, we fused the extracellular region of doBAFF gene with a small
ubiquitin-related modifier gene (SUMO) by over-lap PCR. The resulting fused protein
SUMO-sdoBAFF was highly expressed in DE3(BL21) with a molecular weight of 35 kDa.
The fusion protein was purified by Ni-NTA affinity chromatography and cleaved by a
SUMO-specific protease, Ulp1. The sdoBAFF protein was further purified by Ni-NTA affinity
chromatography. In vitro, the MTT assays indicated that the purified doBAFF as well as
SUMO-sdoBAFF proteins were able to promote bursa lymphocyte survival in dosedependent manner.
ß 2008 Elsevier B.V. All rights reserved.
Keywords:
Dove B lymphocyte stimulator
SUMO
Fusion protein
B cells survival
1. Introduction
Members of the tumor necrosis factor (TNF) family
and their receptors are important regulators of the
immune system (Mak and Yeh, 2002; Gordon et al.,
2003; Kern et al., 2004; Kalled et al., 2005; So et al.,
2006; Pelekanou et al., 2008). The tumor necrosis factor
family member, BAFF also known as BlyS, TALL-1,
THANK, zTNF4 and TNFSF13B, plays an important role
in B lymphocyte maturation and survival (Batten et al.,
2000; Gao et al., 2007). BAFF is a type II membrane
* Corresponding author. Tel.: +86 25 85608666; fax: +86 25 85608666.
E-mail addresses: [email protected] (P. Cao),
[email protected] (S. Zhang).
0165-2427/$ – see front matter ß 2008 Elsevier B.V. All rights reserved.
doi:10.1016/j.vetimm.2008.11.026
protein that can function as the membrane-bound form
or be proteolytically cleaved into a soluble cytokine
(sBAFF) by a protease of the furin family (Schneider
et al., 1999; Bodmer et al., 2002). In vitro, soluble BAFF
was found to promote B cell survival and co-stimulate B
cell proliferation with anti-IgM (Schneider et al., 1999;
Moore et al., 1999). Overexpression of BAFF is closely
involved in the pathogenesis and progression of many
kinds of autoimmune disorders (De Vita et al., 2008).
Therefore, BAFF has been considered as an ideal
therapeutic target for these conditions.
Most of the previous researches mainly focus on
mammalian BAFF, such as human BAFF and mouse BAFF
drive the differentiation of immature B cells into more
mature cells and also to promote B cell survival and
antibody production (Khare et al., 2000; MacLennan and
W. Lu et al. / Veterinary Immunology and Immunopathology 128 (2009) 374–380
Vinuesa, 2002; Sakurai et al., 2007; Gilbert et al., 2006).
Recently, the bioactivity of BAFF in the avian species was
taken close attention. Chicken BAFF (cBAFF) has been
proved that can promote the growth and maturation of
follicular B cells in bursa of fabricius (Koskela et al., 2004;
Guan et al., 2007). Furthermore, recombinant soluble duck
BAFF (duBAFF) and goose BAFF (gsBAFF) purified from
Escherichia coli have a positive effect on bursa B cells
survival and proliferation (Guan et al., 2007; Dan et al.,
2007). Especially, because of high conservation of BAFF in
the evolution, functional cross-reactivity exists between
mammalian and avian BAFF (Guan et al., 2007). In this
paper, we at the first time report the molecular cloning and
bioactivity analysis of doBAFF.
375
Table 1
Primers used in this research.
Primers
Sequence (50 –30 )
doBAFF-1
doBAFF-2
ATGAAATCCGTGGACTGTGTGCACGTC
ACTGAGCCCGGGTCAGAAGAGTCTGACGGCACCACGATAT
sdoBAFF-F
sdoBAFF-R
GGA AT TCCATATGTCTGTTGTCCACAC
CGGGATCCT CAGAAGAGTCTGACGGCAC
b-Actin-F
b-Actin-R
TGATATTGCTGCGCTCGTTG
TCATTGTA GAAAGTGTG
SUBAFF-F
SUBAFF-R
GGAG GTTCTG TTGTCC ACAC
CGGGATCCTCAGAAGAGTCTGACGGCAC
SUMO-F
CGATATACCATGGGTCATCACCATCATCATCACG
GGTCGGACTCAG
GTGTGGACAACAGAACCTCCAATCTGTTCGCGGTG
SUMO-R
2. Materials and methods
2.1. Animals and cell preparations
10-week-old doves (Columba livia domestica) were
purchased from Yuanqiao Meat pigeon farms of Rugao city
of Jiangsu, China. The dove lymphocyte was separated
from bursa of fabricius homogenate using lymphocyte
isolation solution (TBD sciences, China) according to the
manual. All cells were maintained in RPMI 1640 medium
with penicillin/streptomycin (Gibco BRL, US) supplemented with 10% FCS at 37 8C in a CO2 incubator.
2.2. RNA extraction, cDNA synthesis and sequence
comparison
Tissues of dove such as heart, spleen, kidney, liver and
bursa of fabricius were collected and stored in 80 8C ultra
cold freezer after dissect. The total RNA was extracted
using TRIzol reagent (Invitrogen, Carlsbad, CA, US)
according to the standard protocol. RNA quality was
assessed by electrophoresis on 1% agarose gel. Total RNA
was treated with RQ1 RNase-free DNase (Promega, US) to
remove contaminated DNA. To synthesize cDNA by reverse
transcription, 1 mg total RNA, 10 units Reverse Transcriptase XL (AMV) (Takara, Japan) and 50 pmol Random primer
(6 mer) were reacted for 1 h at 42 8C in 20 ml mixture
according to the manufacturer’s instruction.
Degenerate primers doBAFF-1 (Table 1) and doBAFF-2
(Table 1) were used in the PCR. Their design was based on
regions of high homology among the sequences of duck,
human and mouse. PCR was performed by the following
procedure: denature for 30 s at 94 8C, annealing for 30 s at
54 8C, and extension for 1 min at 72 8C, and then 72 8C for
8 min. PCR products from a 1% agarose gel were purified
with the gel purification kit and subcloned into PMD 18-T
vector (Takara, Japan). Positive recombinant colony was
characterized by PCR and further confirmed by DNA
sequencing. The amino acid sequence of doBAFF protein
was compared with avian and mammalian BAFFs from the
GenBank using DNAMAN 10 software. The phylogenetic
analysis was conducted using neighbor joining (NJ) and
minimum evolution, based on amino acid sequences. The
sequence data were transformed into a distance matrix (pdistance). The NJ tree was obtained using MEGA 4.0 with
complete deletions of gaps, and was validated with the
minimum evolution tree. One thousand bootstraps were
performed for the NJ trees to verify results reliability.
2.3. RT-PCR analysis of doBAFF mRNA expression in tissues
The expression of doBAFF was investigated using RTPCR. Equivalent amounts of total RNA, isolated from
bursa of fabricius, spleen, kidney, heart and liver were
reverse transcribed into cDNA as the template for PCR,
first-strand cDNA was obtained from total RNA using
PrimeScriptTM RT-PCR Kit (Takara, Japan) according to
the standard protocol. A variable amount of the cDNA
was used in a total volume of 50 ml of a PCR mixture
using Premix Ex TaqTM. PCR amplification of doBAFF
cDNA was carried out for 30 cycles, with primers
sdoBAFF-F (Table 1) and sdoBAFF-R (Table 1). Amplification was performed at 94 8C for 5 min and 94 8C for 30 s,
50 8C for 30 s, 72 8C for 45 s, finally amplificated 6 min at
72 8C. PCR products were run on a 1% agarose gels.
Columba livia b-actin (GenBank accession number:
DQ022673) expression was used as an internal control
for RNA content and integrity.
2.4. Construction of SUMO-sdoBAFF fusion expression vectors
The DNA fragment encoding the extracellular region
of doBAFF (aa137–288) also known as the soluble form
of doBAFF (sdoBAFF) was amplified by PCR using primers
SUBAFF-F and SUBAFF-R (Table 1) to produce the fusion
gene encoding SUMO-sdoBAFF, the (small ubiquitin-like
modifier) SUMO fragment was amplified from a baculovirus expression plasmid using primers SUMO-F and
SUMO-R (Table 1). The SUMO-R and SUBAFF-F had the
overlapping complementary sequence, while SUMO-F
and sdoBAFF-R had NcoI with His6 tag and BamHI
recognition sites for directed cloning into vector. After
the first round of PCR using SUMO-F/SUMO-R and
SUBAFF-F/sdoBAFF-R, gel purification was performed
for the two products. A second round of PCR followed
using the two resulting PCR products as well as the
SUMO-F and sdoBAFF-R primers to obtain the fragment
encoding SUMO-sdoBAFF. Then the fragment was
digested with NcoI and BamHI and inserted in a frame
into pET28a plasmid (Novagen, US). DH5a competent
376
W. Lu et al. / Veterinary Immunology and Immunopathology 128 (2009) 374–380
cells were first transformed and screened in Luria–
Bertani (LB) medium containing kanamycin (50 mg/ml).
The plasmids were then confirmed by endonuclease
restriction digestion assay and further confirmed by DNA
sequencing. The resulting plasmid was named pET28a/
SUMO-sdoBAFF. The construction of pET28a/His-sdoBAFF was performed according to Cao et al. (2005) with
primers sdoBAFF-F and sdoBAFF-R which had NdeI and
BamHI recognition sites for directed cloning into vector.
2.5. Expression and purification of SUMO-sdoBAFF protein
Inoculate a 100 ml culture (LB, 50 mg/ml kanamycin)
1:50 with the noninduced overnight bacterium and grow
at 37 8C with vigorous shaking until an OD600 of 0.6 is
reached. Then induce expression by adding 0.4 mM IPTG
and cultivate for additional 48 h at 15 8C, 150 rpm. The
soluble protein in the supernatant was collected by
refrigerate centrifugation after hypersound quassation.
Finally, the target protein was purified with His-Bind
Columns (Qiagen, Germany) according to the manual.
2.6. SDS-PAGE and Western blotting
Protein was separated on a 13% polyacrylamide gel
under reducing conditions and then transferred to a PVDF
membrane (Malakhov et al., 2004). The membrane was
soaked for 15 min with transfer buffer (25 mM Tris,
192 mM glycine, 20% (v/v) methanol, pH 8.3) and nonspecific protein binding was blocked by incubating the
Fig. 1. The open reading frame (ORF) of doBAFF cDNA sequence (GenBank accession no. EU334145). The predict transmembrane region is underlined and
the furin cleavage site is shown in italics.
W. Lu et al. / Veterinary Immunology and Immunopathology 128 (2009) 374–380
membrane with 5% MPBS (5% skim milk in PBS, pH 7.4) for
1 h. After washing with PBST (PBS containing 0.05% Tween
20) 15 min, 1:1000 anti-His6 IgG mAb (Novagen, US) was
added into MPBS and incubated for 2 h at 37 8C. The
membrane was washed three times for 10 min with PBST,
incubated for 60 min with a 1:5000 dilution of goat antimouse IgG conjugated with horseradish peroxidase (HRP)
(Santa Cruz Biotechnology, US) in PBST, and subsequently
washed three times for 5 min with PBST. The blot was
performed using the tetramethyl benzidine (TMB) chemiluminescence system (Promega, US).
377
2.7. SUMO fusion enzymolysis
N-terminal His-tagged SUMO protease 1, Ulp1 was
prepared in our laboratory. Mix the purified Ulp1 and
SUMO-sdoBAFF at a proportion of 1:20, dialyze the purified
SUMO-sdoBAFF and Ulp1 mixture at least 24 h at 4 8C
reaction buffer (50 mM Tris–HCl, 150 mM NaCl, 0.5 mM
EDTA, pH 7.9, 10% glycerol). During the dialysis, change the
buffer (1 L) two times to effectively remove the detergent
and imidazole. The digest was purified using Ni-NTA resin
(Qiagen, Germany). SUMO with N-terminal His-tag was
Fig. 2. Comparison of protein sequences from dove, goose, chicken, duck, human and mouse. Sequence of doBAFF (GenBank accession no. EU334145),
gsBAFF (GenBank accession no. DQ874394), dBAFF (GenBank accession no. DQ445092), cBAFF (GenBank accession no. AF506010), mBAFF (GenBank
accession no. AF119383), hBAFF (GenBank accession no. AF116456) were aligned using the DNAMAN program. Grey shading indicates identical residues
among the six sequences.
378
W. Lu et al. / Veterinary Immunology and Immunopathology 128 (2009) 374–380
bound on the column and sdoBAFF was washed out with
500 mM NaCl 20 mM Tris–HCl 50 mM imidazole. Then the
purified sdoveBAFF was dialyzed against TEG (50 mM Tris–
HCl pH 7.9, 50 mM NaCl, 0.5 mM EDTA 5% glycerol) at least
12 h.
2.8. Lymphocytes of fabricius, bursa proliferation assay
MTT assay was used to evaluate the number of viable
cells in each group at different concentrations. For
lymphocyte cell survival assay, the isolated lymphocyte
cells were adjusted to 105 cells/ml and cultured in RPMI
1640 supplemented with 10% FCS and 100 U/ml penicillin/
streptomycin (Gibco BRL, US) in triplicate in 96-well flatbottomed plates. After 4 h accommodative cultivate,
different concentrations SUMO-sdoBAFF and sdoBAFF
were added to stimulate the cells. As controls, stimulated
with His-SUMO in the same concentration gradient. The
cells were incubated at 37 8C in a humidified atmosphere
with 5% CO2 for 72 h. Cell survival was measured by the
MTT method with multiskan spectrum reader (Thermo,
US).
Fig. 3. Phylogenetic tree of BAFFs between dove, goose, chicken, duck,
human and mouse. The tree was generated by MEGA 4.0 software using
the neighbor-joining method. Lengths of horizontal lines indicate genetic
distance. The bootstrap values from 1000 replications are indicated at the
inner nodes.
3. Results
3.1. The cDNA cloning of doBAFF
The cDNA of doBAFF encoding 288 amino acid residues
was cloned from liver tissue by RT-PCR. As shown in Fig. 1,
structural analysis indicated that the doBAFF protein has a
predict transmembrane spanning domain and a putative
furin protease cleavage site similar to other avain and
mammalian BAFFs.
3.2. Sequence comparison
As shown in Fig. 2, sequence comparison indicated that
the amino acid sequence of doBAFF shared high identity to
hBAFF (50.66%), mBAFF (44.69%), dBAFF (90.63%), cBAFF
(91.32%), gsBAFF (91.67%), respectively. Phylogenetic
analysis is based on amino acids sequence information.
Phylogenetic analysis of these species was performed at
the amino acid level. The phylogenetic tree of the BAFF
proteins revealed that these BAFFs were divided into two
Fig. 4. Expression of doBAFF in various tissues were analyzed by RT-PCR.
b-Actin was used as a internal control for the amount and quality of
mRNA. The position control RNA was provided by the RT-PCR kit.
groups: doBAFF, cBAFF, dBAFF, gsBAFF and hBAFF, mBAFF.
As shown in Fig. 3, all of the BAFFs originated from only one
root. DoBAFF, cBAFF, dBAFF, gsBAFF constituted one
subgroup. This same pattern of separation was maintained
when the minimum evolution analysis was used.
3.3. Tissue-specific expression of doBAFF
mRNA in various tissues was analyzed by RT-PCR. As
shown in Fig. 4, the doBAFF mRNA were extensively
expressed in various tissues, whereas high levels of
expression of the doBAFF was observed in the spleen
and bursa of fabricius. In addition, expression was weakly
detected in the heart, liver, and kidney. This suggested that
Fig. 5. (A) Expression analysis of His-doBAFF in BL21(DE3): lane 1, bacterium without IPTG introduction; lane 2, bacterium introduced with 0.4 mM IPTG in
15 8C; lane 3, the supernatant after hypersound quassation and hypothermy centrifugalization. (B) Expression and purification analysis of SUMO-sdoBAFF:
lane 1, bacterium without IPTG introduction; lane 2, bacterium introduced with 0.4 mM IPTG in 15 8C; lanes 3–7, purified SUMO-sdoBAFF with nickelaffinity chromatography. (C) Western blot analysis of SUMO-sdoBAFF with mAb against His6 tag.
W. Lu et al. / Veterinary Immunology and Immunopathology 128 (2009) 374–380
379
doBAFF was the predominant form expressed in lymphatic
organ. As controls, b-actin generated specific bands of
similar intensity in nearly all tissues.
3.4. Soluble expression of sdoBAFF protein by SUMO-fusion
As shown in Fig. 5A, When fused with His6 tag without
SUMO, soluble sdoBAFF was poorly expressed in E. coli and
could not be detected in the supernatant. On the contrary, a
relative concentration of SUMO-sdoBAFF fusion protein
was detected by SDS-PAGE further by Western blot (Fig. 5B
and C). Must be point out that SUMO is about 10 kDa but
runs on an SDS-PAGE gel as 20 kDa. As a result, SUMOsdoBAFF runs as 35 kDa, even though SUMO-sdoveBAFF is
actually 25 kDa.
3.5. Enzymolysis of SUMO-sdoveBAFF with Ulp1
As shown in Fig. 6, after diluted and cleaved by SUMOspecific protease Ulp1, the fusion protein release a 20 kDa
fragment SUMO dimmer and soluble doBAFF about 15 kDa.
After flow through the His-Bind Columns, nearly all the
undigested SUMO-sdoBAFF and SUMO with N-terminal
His-tag were bound on the column.
Fig. 7. Effects of different concentrations sdoBAFF and SUMO-sdoBAFF to
the survival of lymphomonocyte of dove bursa of fabricius in vitro. Fresh
isolated lymphomonocyte of dove bursa of fabricius were incubated with
sdoBAFF and SUMO-sdoBAFF at varying concentrations for 72 h.
lymphomonocyte of dove bursa of fabricius, freshly
isolated bursa lymphocytes were cultured with sdoBAFF
protein. As shown in Fig. 7, after 72 h, although cell death
occurred rapidly due to apoptosis, sdoBAFF dramatically
prolonged the survival of bursa B cells in culture, and
represented a dose-dependent manner to sdoBAFF treatment. The control protein SUMO did not have any survival
effect.
4. Discussion
3.6. Bioactivity of recombinant sdoveBAFF and SUMOsdoBAFF
Both SUMO-sdoBAFF and sdoBAFF could promote the
survival of lymphocyte of dove bursa of fabricius in vitro.
To test the effects of sdoveBAFF to the survival of
Fig. 6. SDS-PAGE analysis of SUMO-sdoBAFF digested by SUMO protease
and purified sdoBAFF. Lane 1, purified fusion SUMO-sdoBAFF using HisBind Columns; lane 2, digestion of purified fusion SUMO-sdoBAFF using
SUMO protease at 4 8C for 24 h; lane 3, the purified sdoBAFF obtained
after reloading the digested sample thought the Ni-NTA column; lane 4,
protein marker.
In the present study, the cDNA sequence of B cell
activating factor from Columba livia domestica was
determined. The cloning strategy was based on nucleotide
sequence homology between the dove and the other
poultry. The protein of doBAFF containing a predicted
transmembrane domain and a putative furin protease
cleavage site like cBAFF, hBAFF and mBAFF. Amino acids
sequence comparison revealed that the doBAFF has a very
high sequence and structural similarity to other avian
BAFFs. From the phylogenetic analysis of BAFF, we
detected the genetic relationship between dove, chicken,
duck, mouse and human. The cladogram indicated that
doBAFF showed a high homology with other BAFFs
especially the avian BAFFs. DoBAFF mRNA was extensively
expressed in various tissues, especially in the lymphatic
organs such as spleen and bursa of fabricius which were
rich with B achroacyte.
As the same as many other heterogenesis proteins,
recombinant BAFF expression in E. coli remains difficult.
Refolding technology and traditional fusion technology
were used to enhance the soluble expression (Guan et al.,
2007; Cao et al., 2005). But low yield, low reproducibility of
refolding technology and inefficient cleavage of traditional
fusion systems were major problems we have faced. SUMO
both enhanced expression and cleavage of the fusion
protein. The effect that SUMO has on enhancing protein
solubility can be explained in part by the structure of
SUMO. SUMO has an external hydrophilic surface and
inner hydrophobic core, which may exert a detergent-like
effect on otherwise insoluble proteins (Butt et al., 2005).
The SUMO-specific protease Ulp1 cleave the conserved
Gly–Gly motif at the C-termini of SUMO from recombinant
fusion protein efficiently in suitable conditions. Unlike EK
or TEV protease, whose recognition sequences are short
and degenerate, Ulp1 recognizes the tertiary sequence of
380
W. Lu et al. / Veterinary Immunology and Immunopathology 128 (2009) 374–380
SUMO. As a result, Ulp1 never cleaves within the fused
protein of interest so we can get intact protein of interest
with little exogenous amino acid residue. We cloned the
sdoBAFF at the 30 end of the His6-SUMO gene by over-lap
PCR. However, when introduced in 37 8C, both SUMOsdoBAFF and His-sdoBAFF were most inclusion body (data
was not shown). So hypothermy induction was used to
improve the yield of soluble proteins. Western blot
analysis of SUMO-sdoBAFF purified from E. coli revealed
a prominent band at 35 kDa, indicative of SUMO-sdoBAFF
soluble expression while nearly no His-sdoBAFF was
detected in the supernatant of lysate even though in the
same introduce condition.
BAFF is a potent survival factor for B cells in mammals,
chicken, goose and duck, while the soluble forms of hBAFF
and mBAFF were biologically active in promoting survival
of B cells treated with anti-IgM in vitro. This also holds true
for the dove system. MTT assays indicated that both
sdoBAFF and SUMO-sdoBAFF can promote the survival of
bursa lymphocyte in dose-dependent.
In summary, this work determined the cDNA sequence
of doBAFF, and analyzed doBAFF mRNA expression in
tissues. Moreover, the construction of SUMO expressing
system supplied an universal method for high level
expression soluble proteins. After all, the bioactivity assay
indicated that sdoBAFF fused with SUMO also have
survival effect to the bursa of fabricius lymphocyte.
Acknowledgements
This work was supported by the Grants from the
International Cooperation of Jiangsu Province (No.
BZ2007078) and the National Nature Science Foundation
of China (No. 30701098).
References
Batten, M., Groom, J., Cachero, T.G., Qian, F., Schneider, P., Tschopp, J.,
Browning, J.L., Mackay, F., 2000. BAFF mediates survival of peripheral
immature B lymphocytes. Exp. Med. 192, 1453–1466.
Bodmer, J.L., Schneider, P., Tschopp, J., 2002. The molecular architecture of
the TNF superfamily. Trends Biochem. Sci. 27, 19–26.
Butt, T.R., Edavettal, S.C., Hall, J.P., Mattern, M.R., 2005. SUMO fusion
technology for difficult-to-express proteins. Protein Exp. Purif. 43, 1–9.
Cao, P., Mei, J.J., Diao, Z.Y., Zhang, S.Q., 2005. Expression, refolding, and
characterization of human soluble BAFF synthesized in Escherichia
coli. J. Protein Exp. Purif. 41, 99–206.
Dan, W.B., Guan, Z.B., Zhang, C., Li, B.C., Zhang, J., Zhang, S.Q., 2007.
Molecular cloning, in vitro expression and bioactivity of goose B-cell
activating factor. J. Vet. Immunol. Immunopathol. 118, 113–120.
De VitaF S., Quartuccio, L., Fabris, M., 2008. Hepatitis C virus infection,
mixed crioglobulinemia cryoglobulinemia and BLyS upregulation:
targeting the infectious trigger, the autoimmune response, or
both? Autoimmun. Rev. (PMID: 18589005).
Gao, H., Bian, A., Zheng, Y., Li, R., Ji, Q., Huang, G., Hu, D., Zhang, L., Gong,
W., Hu, Y., He, F., 2007. sBAFF mutants induce neutralizing antibodies
against BAFF. FEBS Lett. 581, 581–586.
Gilbert, J.A., Kalled, S.L., Moorhead, J., Hess, D.M., Rennert, P., Li, Z., Khan,
M.Z., Banga, J.P., 2006. Treatment of autoimmune hyperthyroidism in
a murine model of Graves’ disease with tumor necrosis factor-family
ligand inhibitors suggests a key role for B cell activating factor in
disease pathology. Endocrinology 147, 4561–4568.
Gordon, N.C., Pan, B., Hymowitz, S.G., Yin, J., Kelley, R.F., Cochran, A.G.,
Yan, M., Dixit, V.M., Fairbrother, W.J., Starovasnik, M.A., 2003. BAFF/
BLyS receptor 3 comprises a minimal TNF receptor-like module that
encodes a highly focused ligand-binding site. Biochemistry 42, 5977–
5983.
Guan, Z.B., Ye, J.L., Dan, W.B., Yao, W.J., Zhang, S.Q., 2007. Cloning,
expression and bioactivity of duck BAFF. Mol. Immunol. 44, 1471–
1476.
Kalled, S.L., Ambrose, C., Hsu, Y.M., 2005. The biochemistry and biology
of BAFF APRIL and their receptors. J. Curr. Dir. Autoimmun. 8, 206–
242.
Kern, C., Cornuel, J.F., Billard, C., Tang, R., Rouillard, D., Stenou, V.,
Defrance, T., Cymbalista, A.F., Simonin, P.Y., Feldblum, S., Kolb, J.P.,
2004. Involvement of BAFF and APRIL in the resistance to apoptosis of
B-CLL through an autocrine pathway. Blood 103, 679–688.
Khare, S.D., Sarosi, I., Xia, X.Z., McCabe, S., Miner, K., Solovyev, I., Hawkins,
N., Kelley, M., Chang, D., Van, G., Ross, L., Delaney, J., Wang, L., Lacey,
D., Boyle, W.J., Hsu, H., 2000. Severe B cell hyperplasia and autoimmune disease in TALL-1 transgenic mice. Proc. Natl. Acad. Sci. U.S.A.
97, 3370–3375.
Koskela, K., Nieminen, P., Kohonen, P., Salminen, H., Lassila, O., 2004.
Chicken B-cell-activating factor: regulator of B-cell survival in the
bursa of fabricius. Scand. Immunol. 59, 449–457.
MacLennan, I., Vinuesa, C., 2002. Dendritic cells, BAFF, and APRIL: innate
players in adaptive antibody responses. Immunity 17, 235–238.
Mak, T.W., Yeh, W.C., 2002. Signaling for survival and apoptosis in the
immune system. Arthritis Res. 4, 243–252.
Malakhov, M.P., Mattern, M.R., Malakhova, O.A., Drinker, M., Weeks, S.D.,
Butt, T.R., 2004. SUMO fusions and SUMO-specific protease for efficient expression and purification of proteins. J. Struct. Funct. Genomics 5, 75–86.
Moore, P.A., Belvedere, O., Orr, A., Pieri, K., LaFleur, D.W., Feng, P., Soppet,
D., Charters, M., Gentz, R., Parmelee, D., Li, Y., Galperina, O., Giri, J.,
Roschke, V., Nardelli, B., Carrell, J., Sosnovtseva, S., Greenfield, W.,
Ruben, S.M., Olsen, H.S., Fikes, J., Hilbert, D.M., 1999. BLyS: member of
the tumor necrosis factor family and B lymphocyte stimulator.
Science 285, 260–263.
Pelekanou, V., Kampa, M., Kafousi, M., Darivianaki, K., Sanidas, E., Tsiftsis,
D.D., Stathopoulos, E.N., Tsapis, A., Castanas, E., 2008. Expression of
TNF-superfamily members BAFF and APRIL in breast cancer: immunohistochemical study in 52 invasive ductal breast carcinomas. BMC
Cancer 8, 76.
Sakurai, D., Kanno, Y., Hase, H., Kojima, H., Okumura, K., Kobata, T., 2007.
TACI attenuates antibody production costimulated by BAFF-R and
CD40. Eur. J. Immunol. 37, 110–118.
Schneider, P., MacKay, F., Steiner, V., Hofmann, K., Bodmer, J.L., Holler, N.,
Ambrose, C., Lawton, P., Bixler, S., Acha-Orbea, H., Valmori, D.,
Romero, P., Wermer-Favre, C., Zubler, R.H., Browning, J.L., Tschopp,
J., 1999. BAFF, a novel ligand of the tumor necrosis factor family,
stimulates B cell growth. J. Exp. Med. 189, 1747–1756.
So, T., Lee, S.W., Croft, M., 2006. Tumor necrosis factor/tumor necrosis
factor receptor family members that positively regulate immunity.
Int. J. Hematol. 83, 1–11.