Download Biology 212 General Genetics

Survey
yes no Was this document useful for you?
   Thank you for your participation!

* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project

Document related concepts

Gene regulatory network wikipedia , lookup

RNA silencing wikipedia , lookup

Promoter (genetics) wikipedia , lookup

Protein (nutrient) wikipedia , lookup

Western blot wikipedia , lookup

Community fingerprinting wikipedia , lookup

Bottromycin wikipedia , lookup

Polyadenylation wikipedia , lookup

Cre-Lox recombination wikipedia , lookup

Protein wikipedia , lookup

Non-coding DNA wikipedia , lookup

Enzyme wikipedia , lookup

Protein moonlighting wikipedia , lookup

Protein adsorption wikipedia , lookup

Transcriptional regulation wikipedia , lookup

RNA-Seq wikipedia , lookup

List of types of proteins wikipedia , lookup

Protein structure prediction wikipedia , lookup

Gene wikipedia , lookup

Two-hybrid screening wikipedia , lookup

Messenger RNA wikipedia , lookup

Amino acid synthesis wikipedia , lookup

Proteolysis wikipedia , lookup

Non-coding RNA wikipedia , lookup

Silencer (genetics) wikipedia , lookup

Biochemistry wikipedia , lookup

Molecular evolution wikipedia , lookup

Deoxyribozyme wikipedia , lookup

Nucleic acid analogue wikipedia , lookup

Gene expression wikipedia , lookup

Expanded genetic code wikipedia , lookup

Artificial gene synthesis wikipedia , lookup

Epitranscriptome wikipedia , lookup

Genetic code wikipedia , lookup

Transcript
Biology 212 General Genetics
Spring 2007
Lectures 2 & 3 "Gene Function I and II"
Reading: Chap. 1 pp. 9-14, 14-22
Lecture outline:
1. Genes code for proteins
2. Inborn errors of metabolism
3. DNARNAprotein
4. Genetic code
5. Mutations
Lecture:
1. Genes code for proteins



order of bases on DNA specifies sequence of amino acids in a protein
proteins control the traits
enzymes are proteins that act as biological catalysts
o break down organic molecules or assemble large molecules from smaller
subunits
2. Inborn errors of metabolism
1908 Archibald Garrod



First to link errors in metabolism to defect in an enzyme
Studied alkaptunuria, a metabolic disease
Patient excretes abnormal substance in urine "homogentisic acid" urine turns
black
Metabolism: chemical reactions in cells
Series of steps
ABCD
A=precursor
B, C=intermediates
D=product
 =enzyme that catalyzes chemical reaction
What happens in alkaptonuria? A critical enzyme is defective in the metabolic pathway
to break down phenylalanine.
Figures 1. 9, 1.10
1
Phenylalanine
X blocked in phenylketonuria
Tyrosine
4-hydroxyphenylpyruvic acid
homogentisic acid [accumulates in alkaptonuria]
X blocked in alkaptonuria
4-maleylacetoacetic acid
Phenylketonuria (PKU)
 Defect in different enzyme in same pathway
 Enzyme defect: phenylalanine hydroxylase
 Phenylalanine accumulates in individuals with the disorder
 Can lead to mental retardation if not treated from birth
 Treat by placing babies on diet low in phenylalanine
 Screening with routine blood test just after birth
 1/8000 among Caucasians in U.S., therefore relatively common
Defects in other enzymes of this pathway lead to other diseases.
3. DNARNA protein
gene = sequence of DNA
mRNA = temporary instructions for making protein
protein = polypeptide chain
 has 3D structure
 proteins carry out a variety of tasks in cell
 many proteins are enzymes (catalysts)
mutant gene
incorrect mRNA
defective protein
 doesn't form correct 3D structure
2
The indirect way genes transfer information to make proteins is called the central
dogma:
DNARNAprotein


DNA does not code for protein directly
RNA acts as an intermediary
RNA=ribonucleic acid
 Similar to DNA
 Contains ribose sugar in place of deoxyribose
 Contains the base uracil (U) in place of thymine (T)
Three types of RNA
mRNA=messenger RNA
 Carries information from DNA
 Used as a template for protein synthesis
rRNA=ribosomal RNA
 Several types of rRNA
 Major components of ribosomes, the site of protein synthesis
 rRNA in the ribosome provides the enzyme for protein synthesis (some enzymes
are RNA)
tRNA=transfer RNA
 small RNAs
 fold in cloverleaf structure
 two functions
o carry an amino acid to the ribosome
o pair via 3 base anticodon to 3 bases on mRNA (codon) to direct correct
incorporation of amino acids into a protein
Process of information transfer
DNA
transcription
mRNA
translation
protein
Shown in more detail in Fig. 1.13
3
Process of transcription (Fig. 1.15)
 DNA opens up
 Ribonucleotides assemble on DNA template
 A pairs with T on DNA
 U pairs with A on DNA
 C pairs with G on DNA
 G pairs with C on DNA
 Synthesized in antiparallel orientation to DNA strand
 RNA synthesis enzyme is RNA polymerase
gene
Initiation site
termination site
Process of translation (Fig. 1.16)
Requires
 mRNA: the coding sequence of bases specifies the amino acid sequence
 tRNA: recognizes the triplets on mRNA and brings in an amino acid
 Amino acid: building blocks of proteins; attach to 3' end of tRNA for assembly
 Ribosome: structure where RNA synthesis occurs
4. Genetic code
How do mRNA instructions specify a particular amino acid?


Requires knowledge of genetic code.
Genetic code discovered by
o Looking at effects of mutations on specified information
o Biosynthesis of proteins in a test tube with isolated components
How to use genetic code table
(Table 1.1)
 Contains sequence of 3 bases on mRNA (codon) that specifies
information for one amino acid
 Read mRNA codon 5' 3'
5' A U G 3'
specifies
met (3 letter abbreviation)
methionine
M (single letter abbreviation)
4
special codons
codon
AUG
UAA
UAG
UGA
Amino acid
Met
No amino acid
DNA
5' ATGTCCACTGCGGTCCTGGAA 3'
3' TACAGGTGACGCCAGGACCTT 5'
mRNA
5' AUGUCCACUGCGGUCCUGGAA 3'
protein
Function
Start codon
Stop codons
NH2--___ --___--___--___--___--___--___--COOH
Use codon table to deduce amino acid sequence this mRNA would specify (Table 1.1)
5. Mutations
 an inherited change in a gene
 often affects the sequence of the protein
mutant
 result of a mutation
 can refer to a mutant gene or mutant organism
Some examples of mutations in the PAH (phenylalanine hydroxylase) gene that can lead
to PKU (see Fig. 1.18 and 1.19):
R408W mutant
 One of four most common mutants
 Codon 408 for arginine (R) is mutated into a codon for tryptophan (W)
 Protein produced has an amino acid substitution
 Mutant protein has no PAH enzyme activity
Many different mutations (>400) can lead to PKU. These include



Missing part of a gene (deletion)
Genetic information to make complete enzyme is lacking
Base substitutions might
o Change start codon
o Change codon in middle of sequence
o Leads to lack of enzyme or altered enzyme
5
Do genes determine destiny? Not completely
Phenotype=physical appearance of trait
is due to
Genotype=all the genes + their interaction with the environment
Example: PKU
 Mutant genetic make-up leads to PKU
 But you can alter affects of PKU by modifying diet (change in environment)
6