Download siRNA expression vector pRNAT-H1

Survey
yes no Was this document useful for you?
   Thank you for your participation!

* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project

Document related concepts

Protein moonlighting wikipedia , lookup

Genetic engineering wikipedia , lookup

Oncogenomics wikipedia , lookup

Biology and consumer behaviour wikipedia , lookup

Epigenetics of neurodegenerative diseases wikipedia , lookup

Molecular cloning wikipedia , lookup

Primary transcript wikipedia , lookup

Epigenetics of depression wikipedia , lookup

Genomic imprinting wikipedia , lookup

Genome (book) wikipedia , lookup

Minimal genome wikipedia , lookup

Genome evolution wikipedia , lookup

Genomics wikipedia , lookup

Ridge (biology) wikipedia , lookup

Microevolution wikipedia , lookup

History of genetic engineering wikipedia , lookup

Metagenomics wikipedia , lookup

DNA vaccination wikipedia , lookup

Cancer epigenetics wikipedia , lookup

No-SCAR (Scarless Cas9 Assisted Recombineering) Genome Editing wikipedia , lookup

Point mutation wikipedia , lookup

Epigenetics of diabetes Type 2 wikipedia , lookup

Designer baby wikipedia , lookup

Gene expression programming wikipedia , lookup

Polycomb Group Proteins and Cancer wikipedia , lookup

Gene wikipedia , lookup

Vectors in gene therapy wikipedia , lookup

Long non-coding RNA wikipedia , lookup

Genomic library wikipedia , lookup

Epigenetics of human development wikipedia , lookup

Site-specific recombinase technology wikipedia , lookup

RNA-Seq wikipedia , lookup

Nutriepigenomics wikipedia , lookup

Mir-92 microRNA precursor family wikipedia , lookup

Therapeutic gene modulation wikipedia , lookup

Gene therapy of the human retina wikipedia , lookup

Gene expression profiling wikipedia , lookup

Artificial gene synthesis wikipedia , lookup

NEDD9 wikipedia , lookup

Transcript
Datasheet Update: 04302009
pDream2.1-cGFP Vector
Cat. No. SD0220
Description: GenScript pDream2.1-cGFP vector is a positive control vector. cGFP gene was cloned into
pDream2.1/Neo and can be expressed directly without any further cloning work in any one of the three major
protein expression systems: Bacteria, Insect cells and Mammalian cells. This vector, with the cGFP gene flanked
by attB1 and attB2 sequences, is compatible with Invitrogen GatewayTM system. This allows you to move the
cGFP gene into other expression vectors from Invitrogen if needed.
CMV Promoter: 1036-1618
T7 Promoter:
1625-1641
P10 Promoter: 1667-1780
attB 1:
1782-1806
cGFP:
1847-2566
attB 2:
2597-2621
SV40 promoter: 3692-4037
Neomycin:
4078-4872
Ampicillin:
6929-7789
pUC ori:
6297-6928
ORF603:
55-1021
ORF1629:
5613-6119
Cloning Region:
Sequencing Primers:
Forward primer DA0009: T7 (TAATACGACTCACTATAGGG)
Reverse primer DA0008: SP6 (TACGATTTAGGTGACACTATAG)
Features:
1.
CMV promoter is for high-level constitutive expression of genes in a variety of mammalian cell lines.
2.
T7 promoter is for convenient expression of genes in bacteria and in vitro transcription/translation analysis
(tm0180).
3.
P10 baculovirus promoter is for high-level expression of genes in baculovirus-infected insect cells.
4.
A Flag tag sequence is placed before cGFP for the single column purification and specific detection of the
fused protein using specific and sensitive anti-Flag antibodies.
5.
The Flag tag sequence is also the cleavage site by enterokinase (EK) to generate an authentic protein
starting with Methionine.
6.
This vector with attB1 and attB2 sequences flanking cGFP is compatible with Invitrogen Gateway
Technology and can be used to move DNA sequence (any genes) into multiple vector systems for functional
analysis and protein expression.
* Limited Use Label License: The use of CMV promoter is covered under U. S. Patent No. 5,168,062 and
5,385,839 owned and licensed by the University of Iowa Research Foundation and is sold for research use only.
Commercial users must obtain a license to these patents directly from the University of Iowa Research Foundation
(UIRF), 214 Technology Innovation Center, Iowa City, Iowa 52242. For further information, please contact the
Associate Director of UIRF, at 319-335-4546.