* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download siRNA expression vector pRNAT-H1
Protein moonlighting wikipedia , lookup
Genetic engineering wikipedia , lookup
Oncogenomics wikipedia , lookup
Biology and consumer behaviour wikipedia , lookup
Epigenetics of neurodegenerative diseases wikipedia , lookup
Molecular cloning wikipedia , lookup
Primary transcript wikipedia , lookup
Epigenetics of depression wikipedia , lookup
Genomic imprinting wikipedia , lookup
Genome (book) wikipedia , lookup
Minimal genome wikipedia , lookup
Genome evolution wikipedia , lookup
Ridge (biology) wikipedia , lookup
Microevolution wikipedia , lookup
History of genetic engineering wikipedia , lookup
Metagenomics wikipedia , lookup
DNA vaccination wikipedia , lookup
Cancer epigenetics wikipedia , lookup
No-SCAR (Scarless Cas9 Assisted Recombineering) Genome Editing wikipedia , lookup
Point mutation wikipedia , lookup
Epigenetics of diabetes Type 2 wikipedia , lookup
Designer baby wikipedia , lookup
Gene expression programming wikipedia , lookup
Polycomb Group Proteins and Cancer wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
Long non-coding RNA wikipedia , lookup
Genomic library wikipedia , lookup
Epigenetics of human development wikipedia , lookup
Site-specific recombinase technology wikipedia , lookup
Nutriepigenomics wikipedia , lookup
Mir-92 microRNA precursor family wikipedia , lookup
Therapeutic gene modulation wikipedia , lookup
Gene therapy of the human retina wikipedia , lookup
Gene expression profiling wikipedia , lookup
Datasheet Update: 04302009 pDream2.1-cGFP Vector Cat. No. SD0220 Description: GenScript pDream2.1-cGFP vector is a positive control vector. cGFP gene was cloned into pDream2.1/Neo and can be expressed directly without any further cloning work in any one of the three major protein expression systems: Bacteria, Insect cells and Mammalian cells. This vector, with the cGFP gene flanked by attB1 and attB2 sequences, is compatible with Invitrogen GatewayTM system. This allows you to move the cGFP gene into other expression vectors from Invitrogen if needed. CMV Promoter: 1036-1618 T7 Promoter: 1625-1641 P10 Promoter: 1667-1780 attB 1: 1782-1806 cGFP: 1847-2566 attB 2: 2597-2621 SV40 promoter: 3692-4037 Neomycin: 4078-4872 Ampicillin: 6929-7789 pUC ori: 6297-6928 ORF603: 55-1021 ORF1629: 5613-6119 Cloning Region: Sequencing Primers: Forward primer DA0009: T7 (TAATACGACTCACTATAGGG) Reverse primer DA0008: SP6 (TACGATTTAGGTGACACTATAG) Features: 1. CMV promoter is for high-level constitutive expression of genes in a variety of mammalian cell lines. 2. T7 promoter is for convenient expression of genes in bacteria and in vitro transcription/translation analysis (tm0180). 3. P10 baculovirus promoter is for high-level expression of genes in baculovirus-infected insect cells. 4. A Flag tag sequence is placed before cGFP for the single column purification and specific detection of the fused protein using specific and sensitive anti-Flag antibodies. 5. The Flag tag sequence is also the cleavage site by enterokinase (EK) to generate an authentic protein starting with Methionine. 6. This vector with attB1 and attB2 sequences flanking cGFP is compatible with Invitrogen Gateway Technology and can be used to move DNA sequence (any genes) into multiple vector systems for functional analysis and protein expression. * Limited Use Label License: The use of CMV promoter is covered under U. S. Patent No. 5,168,062 and 5,385,839 owned and licensed by the University of Iowa Research Foundation and is sold for research use only. Commercial users must obtain a license to these patents directly from the University of Iowa Research Foundation (UIRF), 214 Technology Innovation Center, Iowa City, Iowa 52242. For further information, please contact the Associate Director of UIRF, at 319-335-4546.