* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Download document 5986233
Human genetic variation wikipedia , lookup
Genome evolution wikipedia , lookup
Metagenomics wikipedia , lookup
Gene desert wikipedia , lookup
Neuronal ceroid lipofuscinosis wikipedia , lookup
Nutriepigenomics wikipedia , lookup
Human genome wikipedia , lookup
Gene therapy wikipedia , lookup
Gene expression programming wikipedia , lookup
Genome (book) wikipedia , lookup
Epigenetics of neurodegenerative diseases wikipedia , lookup
Microevolution wikipedia , lookup
Site-specific recombinase technology wikipedia , lookup
Gene expression profiling wikipedia , lookup
Gene therapy of the human retina wikipedia , lookup
Protein moonlighting wikipedia , lookup
Genome editing wikipedia , lookup
Point mutation wikipedia , lookup
Sequence alignment wikipedia , lookup
Designer baby wikipedia , lookup
Gene nomenclature wikipedia , lookup
Helitron (biology) wikipedia , lookup
2008 Spring Biological database Homework 1 This problem set is due by 2PM, March 25, 2008. You shall upload your answers to your web site as instructed by your TA. For all questions, please make a reference such as screen-shot to indicate the source of your answer. 1. Here is a nucleotide sequence: CTCCAGGCCCGTGGGGCTGGCCCTGCACCGCCGAGCTTCCCGGGATGAGGGCCCCCGGTGTGGTCACCCG GCGCGCCCCAGGTCGCTGAGGGACCCCGGCCAGGCGCGGAGATGGGGGTGCACGAATGTCCTGCCTGGCT GTGGCTTCTCCTGTCCCTGCTGTCGCTCCCTCTGGGCCTCCCAGTCCTGGGCGCCCCACCACGCCTCATC TGTGACAGCCGAGTCCTGGAGAGGTACCTCTTGGAGGCCAAGGAGGCCGAGAATATCACGACGGGCTGTG CTGAACACTGCAGCTTGAATGAGAATATCACTGTCCCAGACACCAAAGTTAATTTCTATGCCTGGAAGAG GATGGAGGTCGGGCAGCAGGCCGTAGAAGTCTGGCAGGGCCTGGCCCTGCTGTCGGAAGCTGTCCTGCGG GGCCAGGCCCTGTTGGTCAACTCTTCCCAGCCGTGGGAGCCCCTGCAGCTGCATGTGGATAAAGCCGTCA GTGGCCTTCGCAGCCTCACCACTCTGCTTCGGGCTCTGGGAGCCCAGAAGGAAGCCATCTCCCCTCCAGA TGCGGCCTCAGCTGCTCCACTCCGAACAATCACTGCTGACACTTTCCGCAAACTCTTCCGAGTCTACTCC AATTTCCTCCGGGGAAAGCTGAAGCTGTACACAGGGGAGGCCTGCAGGACAGGGGACAGATGACCAGGTG TGTCCACCTGGGCATATCCACCACCTCCCTCACCAACATTGCTTGTGCCACACCCTCCCCCGCCACTCCT GAACCCCGTCGAGGGGCTCTCAGCTCAGCGCCAGCCTGTCCCATGGACACTCCAGTGCCAGCAATGACAT CTCAGGGGCCAGAGGAACTGTCCAGAGAGCAACTCTGAGATCTAAGGATGTCACAGGGCCAACTTGAGGG CCCAGAGCAGGAAGCATTCAGAGAGCAGCTTTAAACTCAGGGACAGAGCCATGCTGGGAAGACGCCTGAG CTCACTCGGCACCCTGCAAAATTTGATGCCAGGACACGCTTTGGAGGCGATTTACCTGTTTTCGCACCTA CCATCAGGGACAGGATGACCTGGAGAACTTAGGTGGCAAGCTGTGACTTCTCCAGGTCTCACGGGCATGG Please use database mining tools of your choice to tell me as much as you can about this sequence. i. What gene does this sequence represent in human? What is its GI number? GenBank Accession number? Gene symbol? Unigene ID? Ans: Homo sapiens erythropoietin (EPO) Ans: Gi=62240996 Ans: accession number=NM_000799 Ans: gene symbol=EPO ; UGID=131206 ii. What database(s) did you search, and what tool(s) did you use in your search? What parameter settings did you use? Ans: NCBI/NCBI BLAST/nucleotide blast→FASTA format→Human genome plus transcripts→BLAST iii. Retrieve one ortholog of this gene’s complete mRNA sequence and Protein sequence in FASTA format. Compare the results obtained by blastn vs. blastp. I used Genecards database to find the orthologues of human EPO, and I chose “Dog orthologue” to answer this question. The dog’s EPO mRNA FASTA sequence retrieved from NCBI. The dog’s EPO protein FASTA sequence retrieved from NCBI. The result of BLASTP The result of BLASTN Ans: BLASTN: Search a nucleotide database using a nucleotide query. BLASTP: Search protein database using a protein query. iv. Retrieve at least 5 homologenes of this gene. Perform a multiple sequence alignment? The human sequence is most similar to what organism? I used NCBI HomoloGene database to find EPO homologenes. Download the homologene file. used the homologene file to do Multi alignment. Ans: The human sequence is most similar to Common Chimpanzee (Pan troglodytes). v. Is the secondary structure of this protein known? If so, how many “helical fold”are there in its 3D protein structure? How did you determine the exact amino acid number of each helical region? Ans: YES. There are four helical folds in 3D structure. Ans: PDB→sequence details. vi. Is the function of this protein known? If so, what does it do? Ans: Yes. erythropoietin is the principal hormone involved in the regulation of erythrocyte differentiation and the maintenance of a physiological level of circulating erythrocyte mass. vii. Which normal human tissues is this gene mainly expressed in? How did you determine this? Ans: eye、prostate. NCBI Unigene→epo expression profile. viii. Is this protein involved in any biological pathway(s)? If so, what does the pathway do? Ans: Yes. JAK-STAT signaling pathway. ix. Do any other databases contain information about the superfamily of this target gene product? Which superfamily? How did you find out? Ans: Yes. 4-helical cytokines superfamily. I used the PDB database. x. Look for publications relevant to the function(s) of this protein in the biomedical literature. Show one abstract of a relevant article. xi. Show the protein 3-D structure if there is any. 1. Find the zebra fish homolog of the above gene. And answer the following questions: i. The zebra fish homolog is located on which chromosome? And in Human? Ans: Chromosome 7 Ans: Chromosome 7 ii. Perform a cDNA and Polypeptide sequence alignment between human and zebra fish of this gene. This is cDNA sequence alignment of EPO between human and zebrafish. This is polypeptide sequence alignment of EPO between human and zebrafish. iii. How many exons does this gene have in zebrafish? How did you determine this? Ans: 5 exons. I used Ensambl database→exon information. iv. What is the expression pattern of this gene in zebrafish? In human? In mouse? Zebrafish EPO Human EPO There is no expression profile about EPO in mouse.