Download Komaei presentation

European hazelnut
(Corylus avellana)
Golnaz Komaei
Hazelnut Breeding
 I originally come from Iran.
 Bachelor: Agronomy and Plant Breeding at University of Tehran(2009)
 Master : Genetics and Plant Breeding( Wheat breeding) at University of
Tehran(2012)
 Worked as a graduate student on wheat breeding program at University of
Nebraska-Lincoln(2013)
 PhD student, working on hazelnut breeding program with Shawn Mehlenbacher at
Oregon State University(2014)
Areas of commercial production located near large bodies of water at mid-latitudes
in the Northern Hemisphere with mild, moderate temperatures in winter and
summer, and high humidity during mid-winter bloom (along the Black Sea in Turkey,
the Mediterranean in Italy and Spain, the Atlantic coast in France, the Willamette
Valley in Oregon)
Turkey with 70% of the world’s production is the largest hazelnut producer
followed by Italy, United States, Azerbaijan and Georgia.
In the United States, 99% of the hazelnuts are produced primarily in the
Willamette Valley of Oregon.
 Small genome (~400 Mb)
 Highly heterozygous diploid (2n= 2x= 22)
(two different alleles of a gene)
 Monoecious
(having both the male and female reproductive organs in the same tree)
 Clonally propagated tree
 Cross pollinated crop
(pollen should come from another tree)
 Two characteristics of hazelnuts enforce the cross
pollinating:
 Incompatibility
 Dichogamy
Steps for controlling crosses
Incompatibility
 Controlled by S-locus with multiple alleles
 33 alleles controlling self-incompatibility
 Each allele is defined by a number
Dichogamy
The male and female reproductive elements mature at
different times, thus preventing self-pollination.
Research plan
1)
Study the inheritance of eastern filbert blight resistance from new sources, with
an emphasis on Moscow selections and Holmskij OSU 1187.101.
2)
3)
Generate a high-density map for hazelnut using genotyping-by-sequencing.
Integrate the high-density map, physical map of BACs and the genome sequence
of 'Jefferson' hazelnut.
What is the problem?
Eastern filbert blight (EFB)
 Discovered in the Willamette Valley in 1986.
 The fungus has a 2-year life cycle, Ascospores are released in winter
and spread by rain and wind.
 12-16 months after infection, cankers become visible.
The costs and labor involved with controlling the disease
with cultural practices and fungicides are intensive.
Our solution!!
Host genetic resistance
 Resistance to EFB was first discovered in ‘Gasaway’,
which is controlled by a dominant allele at a single
locus.
So, Are we done?!
 Resistance based on the single dominant gene
from‘Gasaway’ may not be durable.
 New races of the fungus that can overcome this R-gene
may be introduced or arise from mutation or
recombination.
 How to solve it??
"Pyramiding" of different R genes
 To find out that if the tree has a resistant gene or not
we need both phenotypic data and genotypic data.
 Inoculation with spores of fungi
 Using genetic marker
Molecular markers are genetic loci that can be easily tracked and
quantified in a population and may be associated with a particular
gene or trait of interest
Steps for collecting phenotypic data
Simple Sequence Repeats
•SSRs are repeating sequence of 2-6 bp of DNA segments.
•Mutation, replication slippage, unequal crossover evolves
microsatellites.
•Wide application in plant breeding.
 Polymorphism is the number of (AAGC) repeats.
Individual 1:
TGATTAAAGCGTGATGGAAGCAAGCAAGCAAGCTAGTTGTAAAGG
Individual 2:
TGATTAAAGCGTGATGGAAGCAAGCAAGCAAGCAAGCTAGTTGTAAAGG
Individual 3:
TGATTAAAGCGTGATGGAAGCAAGCAAGCAAGCAAGCAAGCAAGCTAGTT
GTAAAG
Genetic Linkage Maps
•Representation of the relative position of genes or
markers along a chromosome
•Chromosome = “linkage group”
•Map positions inferred from recombination frequencies
between genes or markers.
Uses of Genetic Linkage Maps
•Gene localization
•Starting point for map-based cloning
•Marker assisted selection
•Genome assembly improvement
Sources of resistance:
•EFB resistance from 'Gasaway' was assigned to linkage group 6
(LG6)
•C. heterophylla ‘Ogyoo’, ‘Grand Traverse’, Uebov (LG6)
•OSU 408.040, ‘Culpla’, ‘Crvenje, OSU 495.072 (LG6)
•'Ratoli‘, C.americana ‘Rush’, Yoder#5 (LG 7)
•Georgian OSU 759.010 (LG 2)
(Mehlenbacher et al.,2006, Lunde et al.,2000, Sathuvalli et al.,2011, Sathuvalli et
al.,2011, Sathuvalli et al.,2012, Bhattarai 2015)
 Genetic linkage maps have been constructed in clonal
species:
a.Potatoes (Tanksley et al. 1992; van Os et al. 2006)
b.Cassavas (Fregene et al. 1997; Kunkeaw et al. 2010)
c.Sweet potatoes (Li et al. 2010)
d.Sugarcanes (Liu et al. 2010)
e.Populus (Zhang et al. 2000)
f.Pears (Yamamoto et al. 2002)
g.Apples (Hemmat et al. 1994)
h.Pineapples (Carlier et al. 2004)
A linkage map for European
hazelnut (Corylus avellana L.)
was constructed using random
amplified polymorphic DNA
(RAPD) and simple sequence
repeat (SSR) markers
Timelines
Please stop by my office if you have any questions.
 ALS 4021
 Office Hours: Fridays, 1 - 2