Download Experiment 1: Determining the presence of E. coli and H. pylori in

Experiment 1: Determining the presence of E. coli and H. pylori in
water samples, using PCR
Goal: To sample water for the presence of E. coli, Shiga toxin-producing strains of
E. coli, and Helicobacter pylori.
Introduction
Escherichia coli is a bacterium that commonly inhabits the lower intestine of warm-
blooded animals. It is part of the normal gut flora, performing necessary functions
like producing vitamin K2, and preventing establishment of pathogenic bacteria.
However, E. coli is able to survive for short periods of time outside of its host, and
therefore it is an ideal indicator of fecal contamination of water.
E. coli usually reproduces clonally (without sex, so offspring are genetically
identical to parent cells), and clones (also called strains) are host specific. Each
clone is genetically different from other clones, so it is possible to trace water
contamination to certain hosts, such as humans, cattle, or birds. It is also possible
to locate the geographic source of contamination by tracking a specific strain
upstream to find where it entered the water supply.
Human babies usually acquire E. coli within 40 hours of birth. The vast
majority of strains that humans are exposed to are non-pathogenic, but in some
cases the strain has acquired a gene that confers virulence. In the case of strain
O157:H7, the most common cause of food recalls, a gene (actually two genes) for
Shiga toxin is present. Shiga toxins inhibit protein synthesis, causing cell death,
and leading to bloody diarrhea and, sometimes, kidney failure in humans. E. coli
strain O157:H7 inhabits cattle intestines, so is most commonly acquired by eating
undercooked meat or unpasturized milk, but it can travel through water and cause
infection to swimmers, or contaminate vegetable crops via irrigation water.
The presence of E. coli in water is usually determined through culturing of
water samples in Petri plates containing a nutrient medium. Once cells are cultured,
DNA can be extracted and various tests can be done to determine the presence of
virulence genes and to fingerprint strains for source tracking.
Helicobacter pylori also inhabits humans, in this case the stomach and
duodenum. Although the majority of people infected by this bacterium show no
signs of disease, in many cases the infection leads to ulcers, gastritis and even
cancer. It has been estimated that two-thirds of the world population are infected
with H. pylori, making it the most widespread infection in the world. Gastric ulcers,
long thought to be caused by stress or spicy food, are now known to be caused by
H. pylori infection, and are successfully treated with antibiotics. There is some
1
evidence to suggest that H. pylori may have a beneficial effect in regulating acidity
of the stomach, but this hypothesis is not universally accepted.
E. coli cells are approx 0.8 x 2 µm, and H. pylori cells are 0.5 x 3 µm.
H. pylori is thought to be passed between people primarily through fecescontaminated water. However, H. pylori is also present in saliva and on tooth plaque,
suggesting that it may be passed orally, as well. Unlike E. coli, H. pylori cannot be
easily cultured, in part because it forms resistant structures in water, and also
because it does it not grow in ordinary aerobic conditions. Therefore, the most
effective way to identify H. pylori in water samples is by extracting total DNA
from samples, and testing, by PCR, for genes found only in H. pylori.
Overview of Experiment 1
Our goal in this experiment is to sample water for the presence of E. coli, Shiga
toxin-producing strains of E. coli, and Helicobacter pylori. Each team will extract
DNA from a water sample by filtering to concentrate water-borne microbes, then
use the EZNA kit to extract DNA from the filter. Each sample will be used in four
PCR reactions—one will test for a broad range of bacteria, and three more will test
for the three taxa listed above. In addition, we will have negative controls to
ensure that we are not introducing contamination along the way, and positive
controls, to be sure our PCR is working.
2
Procedure
A. DNA extraction using EZNA water kit
1. Determine the volume of your water sample, then filter the sample using 0.45 µm
microporous filter paper.
2. Wipe a pair of scissors with 70% ethanol, then cut the filter into quarters.
Insert all pieces into a 50 ml centrifuge tube.
3. Add 3 ml SLX buffer and 500 mg glass beads to the tube. Vortex at maximum
speed for 5-10 minutes, until sample is thoroughly homogenized.
4. Incubate at 70°C for 10 min. Mix sample 2-3 times during incubation by
vortexing the tube.
5. Add 1 ml buffer P2 to tube and vortex for 30 sec. Incubate on ice for 5 min.
6. Centrifuge at 4000 x g (6000 rpm) for 10 min at room temperature.
7. Transfer the supernatant to a 15 ml tube, determine the amount, then pour into
a new 50 ml tube. Add 0.7 volumes of isopropanol. Mix by inverting 20 times.
8. Centrifuge at 4000 x g for 10 min at room temperature to pellet the DNA.
*Note which side of tube is up so that you can locate your pellet if it’s not visible.
Carefully remove and discard the supernatant. Do not disturb the pellet!
9. Add 400 µl elution buffer to tube, and vortex for 20 sec. Incubate at 65°C for
10 min to suspend the DNA.
10. Transfer the sample to a 1.5 ml tube. Vortex the bottle of HTR reagent, and
add 100 µl HTR reagent to sample. Vortex for 10 sec. Incubate at room temp for 2
min.
11. Centrifuge at 14,000 x g (13,500 rpm) for 3 min to pellet the HTR reagent.
Note: If the sample still has a dark color, repeat steps 10 & 11.
12. Transfer the cleared supernatant (approx 400 µl) to a new 1.5 ml tube. Add an
equal volume of buffer XP1. Mix thoroughly.
3
13. Place a HiBind® DNA column into a 2 ml collection tube. Add 100 µl equilibration
buffer, then spin at 14,000 x g for 1 min.
14. Place entire sample into column with collection tube. Centrifuge at 10,000 x g
(11,500 rpm) for 1 min. The DNA is now attached to the membrane. Discard the
flow-through, but reuse the collection tube for the next step.
15. Add 300 µl buffer XP1 to column. Centrifuge at 10,000 x g for 1 min. Discard
flow-through and collection tube. Place the column in a new collection tube.
16. Add 750 µl wash buffer, and centrifuge at 10,000 x g for 30 sec. Discard flowthrough and reuse collection tube.
17. Spin at maximum speed (14,000 x g) for 2 min to dry the column. Any trace of
ethanol (from wash buffer) can inhibit subsequent reactions.
18. Place the column into a new 1.5 ml tube. Add 50 µl elution buffer to the center
of the membrane. Incubate at 65°C for 5 min.
19. Centrifuge at maximum speed for 1 min. Discard the column—the DNA is in the
flow-through. Carefully label the tube of DNA. Store samples at -20°C.
B. PCR
For this part of experiment, each team will mix the reagents for a PCR reaction
that will be performed on each team’s DNA. Each team will mix enough master mix
for six reactions: a reaction for each of the four water samples, plus a negative
control and a positive control. All ingredients in the master mix are the same for
each team, except for the primers.
Team
Primer names
Expect to amplify
1
Ecoli-f & Ecoli-r
2
3
uidAF & uidAR
stx2f & stx2r
4
glmM-f & glmM-r
ribosomal gene from many
bacteria
β-glucuronidase gene of E. coli
Shiga toxin 2 gene of E. coli
O157:57
phosphoglucosamine mutase
gene of H. pylori
Expected
band size
≈1400 bp
486 bp
482 bp
294 bp
4
1. In a 1.5 ml tube combine, in order:
199 µl sterile dH2O
65 µl polymerase buffer (5X)
11.7 µl dNTP mix (4 mM)
7.8 µl forward primer (10 µM)
7.8 µl reverse primer (10 µM)
1.3 µl Taq polymerase
Vortex briefly to mix all reagents, then spin for one or two seconds. Keep the
tubes on ice, and also the tubes for the following steps.
2. Place six 0.2 ml PCR tubes on your rack. Label each with your team number, then
label each 1 through 6.
3. Place 45 µl of your mixture into each tube. To tube 5, add 5 µl sterile dH2O. To
tube 6, add 5 µl control DNA, and close the caps of tubes 5 and 6.
4. Place all tubes in a single rack in the following arrangement:
#1 mix
#2 mix
#3 mix
#4 mix
#1 DNA
#2 DNA
#3 DNA
#4 DNA
1.1
2.1
3.1
4.1
1.2
2.2
3.2
4.2
1.3
2.3
3.3
4.3
1.4
2.4
3.4
4.4
Neg.
control
1.5
2.5
3.5
4.5
Pos.
control
1.6
2.6
3.6
4.6
5. Add your team’s DNA to the appropriate tubes, and close the caps.
Centrifuge tubes briefly to remove any air bubbles, then place in PCR machine.
The PCR machine will cycle through several temperatures to denature the DNA,
allow the primers to bind, and then allow the polymerase to make more DNA,
starting at the primers, and using the sample DNA as a template. The parameters
for this experiment are:
95°C 5 min
30 cycles of 94°C 45 sec
50°C 45 sec
72°C 90 sec
72°C 7 min.
5
6. While the machine is running, make the 1% agarose gel as follows (two per class):
40 ml 1X TAE buffer
0.4 g agarose
Microwave for 1 min, swirl, microwave 15 sec, swirl again, then a final 15 sec in the
microwave. The agarose should be completely dissolved.
Arrange the gel tray in the rack with a 13 well comb. Gently pour the agarose into
the tray so that no bubbles form. Allow to cool completely before removing comb—
at least 20 minutes.
7. Load the gel. To each tube add 10 µl loading dye. Pipette up and down several
times to mix. Load 20 µl of PCR product into well. Load 5 µl of 1 kb ladder to middle
well. Run gels at 100 V for approx 20 minutes, or until loading dye has traveled
about 5 cm (2 in).
8. Place the gel in a 0.002% solution of methylene blue in 0.1X TAE for 1-4 hours at
room temperature. If destaining is necessary, use 0.1X TAE, agitate gently, and
change buffer every 30 minutes.
6
Results and data analysis
Draw the visible bands on the gels below.
Are the bands that you see the sizes that you expected?
Which samples are bacterium-free?
7
Which samples contain E. coli?
Which contain E. coli O157:H7?
Which contain H. pylori?
How do these results compare to your expectations?
Additional questions
What is the purpose of experimental controls?
More specifically, what controls should we have for this experiment, and why?
Why are we using 0.45 µm filter paper?
8
Primer sequences
For many bacteria (from a kit produced by Edvotek):
Ecoli-f
CCGAATTCGTCGACAACAGAGTTTGATCCTGGCTCAG
Ecoli-r
CCCGGGATCCAAGCTTACGGCTACCTTGTTACGACTT
For E. coli (from Heininger et al, 1999)
uidAF
ATCACCGTGGTGACGCATGTCGC
uidAR
CACCACGATGCCATGTTCATCTGC
For Shiga toxin 2 (from Fode-Vaughan et al, 2003):
stx2f
TTCTTCGGTATCCTATTCCC
stx2r
ATGCATCTCTGGTCATTGTA
For H. pylori (from Shahamat et al, 2004):
glmM-f
AGGCTTTTAGGGGTGTTAGGGGTTT
glmM-r
AAGCTTACTTTCTAACACTAACGC
PCR master mix, per 50 µl reaction
30.6 µl sterile dH2O
10 µl polymerase buffer (5X)
1.8 µl dNTP mix (4 mM)
1.2 µl forward primer (10 µM)
1.2 µl reverse primer (10 µM)
0.2 µl Taq polymerase
5.0 µl DNA
50 µl
9
References
Fode-Vaughan, K.A., J.S. Maki, J.A. Benson and M.L.P. Collins. 2003. Direct PCR
detection of Escherichia coli O157:H7. Letters in Applied Microbiology 37:
239—243.
Heininger, A., M. Binder, S. Schmidt, K. Unertl, K. Botzenhart and G. Döring. 1999.
PCR and blood culture for detection of Escherichia coli bacteremia in rats.
Journal of Clinical Microbiology 37: 2479—2482.
Shahamat, M., M. Alavi, J.E.M. Watts, J.M. Ganzalez, K.R. Sowers, D.W. Maeder
and F.T. Robb. 2004. Development of two PCR-based techniques for
detecting helical and coccoid forms of Helicobacter pylori. Journal of
Clinical Microbiology 42: 3613—3619.
Voytek, M.A., J.B. Ashen, L.R. Fogarty, J.D. Kirshtein and E.R. Landa. 2005.
Detection of Helicobacter pylori and fecal indicator bacteria in five North
American rivers. Journal of Water and Health 3.4: 405—422.
10