* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download Genes As Information
Epigenetics of neurodegenerative diseases wikipedia , lookup
DNA damage theory of aging wikipedia , lookup
Gene nomenclature wikipedia , lookup
United Kingdom National DNA Database wikipedia , lookup
Protein moonlighting wikipedia , lookup
Genealogical DNA test wikipedia , lookup
Site-specific recombinase technology wikipedia , lookup
Cancer epigenetics wikipedia , lookup
Molecular cloning wikipedia , lookup
Cell-free fetal DNA wikipedia , lookup
Non-coding DNA wikipedia , lookup
Nucleic acid analogue wikipedia , lookup
Nucleic acid double helix wikipedia , lookup
Epigenomics wikipedia , lookup
Extrachromosomal DNA wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
Deoxyribozyme wikipedia , lookup
DNA vaccination wikipedia , lookup
DNA supercoil wikipedia , lookup
Nutriepigenomics wikipedia , lookup
Designer baby wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
History of genetic engineering wikipedia , lookup
Point mutation wikipedia , lookup
Helitron (biology) wikipedia , lookup
Therapeutic gene modulation wikipedia , lookup
Genes As Information Alleles What alleles you have will determine what traits you have. Each person has two alleles, or versions, of each gene For example, if you have dimples you might have the allele combination Dd Dd Why do you have two? You have two pairs for each chromosome Why are there two? The gene is on both pairs, but the version of the gene might be different. Each version is an allele One allele is on one of the pairs. D d Gene is a section of DNA Chromosomes are made of tightly wound DNA. A section of the DNA is the gene. Chromosome Allele DNA DNA contains information in the form of A T C G. The letter stands for the chemical that is present on the rung of the double helix There are lots of types of information! This is information for proteins The combination ATCG is the instructions for the protein that will be made. ATGAGCCAGACACAACGCAAAACGCTGA CGCTATTTGTGCTGGTACTGATCGGCATTA ATATGCGCCCGCTACTGACCTCGATAGGT CCA TTACTGCCGCAACTGCGGCA CGCAA CTGGCATGAGCTTTACCTGGTTTCACTACT GACCGCCCTTCCGGTCATCGCGATGGGG GTGCTGGCGCTTGCCGGAGGCTGGGTTA ACCGCCACGTTAGTGAAA ACCGCAGTATC GCGCTAAGTCTGCTGGCGATTAGCATTGG CGCGATGCTGCGTGAGCTGGCGCCGCA AAGCGGTCTGCTGCTTAGCAGCGCGCTG CTCGGCGGGATTGGCATCGGCGTGA TTC AAGCGAT… Similar to a recipe for cookies The recipe for a cookie gives you instructions for how to make a cookie. Combine: 2 1/4 cups flour 1 teaspoon baking soda 1 teaspoon salt 1 cup (2 sticks) butter, softened 3/4 cup granulated sugar 3/4 cup packed brown sugar 1 teaspoon vanilla extract 2 large eggs 2 cups Semi-sweet chocolate chips Bake at 350 for 15 min Changes in the DNA If there is a change in the DNA then the instructions for making the protein will be different. If the instruction for making a protein is different than the protein made with those instruction will be different. ATGAGCCAGACACAACGCAAAACGCTGA CGCTATTTGTGCTGGTACTGATCGGCATTA ATATGCGCCCGCTACTGACCTCGATAGGT CCA TTACTGCCGCAACTGCGGCA CGCAA CTGGCATGAGCTTTACCTGGTTTCACTACT GACCGCCCTTCCGGTCATCGCGATGGGG GTGCTGGCGCTTGCCGGAGGCTGGGTTA ACCGCCACGTTAGTGAAA ACCGCAGTATC GCGCTAAGTCTGCTGGCGATTAGCATTGG CGCGATGCTGCGTGAGCTGGCGCCGCA AAGCGGTCTGCTGCTTAGCAGCGCGCTG CTCGGCGGGATTGGCATCGGCGTGA TTC AAGCGAT… Changes in the recipe If there is a change in the cookie recipe than the instruction for making the cookie will be different. If the instruction for making a cookie is different than the cookie made with those instruction will be different. Combine: 2 1/4 cups flour 1 teaspoon baking soda 1 teaspoon salt 1 cup (2 sticks) butter, softened 3/4 cup granulated sugar 3/4 cup packed brown sugar 1 teaspoon vanilla extract 2 large eggs 2 cups Semi-sweet chocolate chips Bake at 350 for 15 min Changes can effect the outcome If peanut butter is added to the recipe than you make peanut butter cookies. They are still cookies but they are different than the original chocolate chip. Combine: 2 1/4 cups flour 1 teaspoon baking soda 1 teaspoon salt 1 cup (2 sticks) butter, softened 3/4 cup granulated sugar 3/4 cup packed brown sugar 1 cup of peanut butter 1 teaspoon vanilla extract 2 large eggs Bake at 350 for 15 min Changes can effect the outcome Changing the brand of chocolate chips will not change that is it a chocolate chip cookie. So some changes have little or no effect on the end product. Combine: 2 1/4 cups flour 1 teaspoon baking soda 1 teaspoon salt 1 cup (2 sticks) butter, softened 3/4 cup granulated sugar 3/4 cup packed brown sugar 1 teaspoon vanilla extract 2 large eggs 2 cups ChocoLOTS brand) Semisweet chocolate chips Bake at 350 for 15 min Changes can affect the outcome Changing the word “sugar” to “salt” will make a big change in the cookies. They won’t even be cookies! Combine: 2 1/4 cups flour 1 teaspoon baking soda 1 teaspoon salt 1 cup (2 sticks) butter, softened 3/4 cup Salt 3/4 cup packed brown sugar 1 teaspoon vanilla extract 2 large eggs 2 cups Semi-sweet chocolate chips Bake at 350 for 15 min Mutations are changes in DNA DNA is the recipe for proteins If the DNA is changed the protein will also change The change could: Have no effect on the protein Change the protein Make it not work anymore Gene is the information for a protein The recipe is holding information for making cookies. The same way if the dna sequence of a gene is the information for making proteins.