* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Download genetics review package
SNP genotyping wikipedia , lookup
Gel electrophoresis of nucleic acids wikipedia , lookup
DNA polymerase wikipedia , lookup
Genome evolution wikipedia , lookup
Zinc finger nuclease wikipedia , lookup
Dominance (genetics) wikipedia , lookup
United Kingdom National DNA Database wikipedia , lookup
DNA damage theory of aging wikipedia , lookup
Cancer epigenetics wikipedia , lookup
Epigenetics of human development wikipedia , lookup
No-SCAR (Scarless Cas9 Assisted Recombineering) Genome Editing wikipedia , lookup
Genomic library wikipedia , lookup
Genealogical DNA test wikipedia , lookup
Genome (book) wikipedia , lookup
Nutriepigenomics wikipedia , lookup
Nucleic acid double helix wikipedia , lookup
Genetic engineering wikipedia , lookup
DNA vaccination wikipedia , lookup
X-inactivation wikipedia , lookup
Molecular cloning wikipedia , lookup
Non-coding DNA wikipedia , lookup
Neocentromere wikipedia , lookup
Epigenomics wikipedia , lookup
Nucleic acid analogue wikipedia , lookup
Primary transcript wikipedia , lookup
DNA supercoil wikipedia , lookup
Cell-free fetal DNA wikipedia , lookup
Genome editing wikipedia , lookup
Extrachromosomal DNA wikipedia , lookup
Site-specific recombinase technology wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
Point mutation wikipedia , lookup
Deoxyribozyme wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
History of genetic engineering wikipedia , lookup
Designer baby wikipedia , lookup
Helitron (biology) wikipedia , lookup
Therapeutic gene modulation wikipedia , lookup
Biology 30 Genetics Exam Review Omit Part A: Cell Division 1. Define the following terms: a. Chromatin – loosely packed DNA during interphase b. Chromosome – DNA that is coiled and packed into strands during replication c. Gene – a section of DNA that codes for a specific protein d. Dyad – two strands of chromosomes joined by a centromere e. Tetrad – four strands of DNA (2 dyads) found in meiosis f. Centromere – structure that holds sister chromatids together g. Monosomy – condition where an individual only inherits one chromosome from a pair h. Trisomy – condition where an individual inherits three chromosomes instead of one pair i. Homologous pair – two chromosomes that consist of the same kinds of information j. Sister Chromatids – two identical copies of a specific chromosome k. Synapsis – during prophase, the tetrads are intertwined l. Haploid – cell (gamete) with one set of chromosomes m. Diploid – cell with two complete sets of chromosomes (zygote) n. Reduction division – division where the number of chromosomes is halved o. Cytokinesis – splitting of the cytoplasm during cell division p. Crossing over – two homologous chromosomes exchange DNA 2. Describe briefly, what is happening at each of the following stages of cell division. Interphase – Cell processes occur, DNA replication, protein synthesis Prophase – Nuclear membrane disappears, nucleolus disappears, chromosomes are formed, cell is preparing to divide Metaphase – Chromosomes line up along the equator, preparing to split evenly to opposite poles Anaphase – Chromosomes pull back to the opposite poles of the cell Telophase – Nucleolus reappears, nuclear membrane reforms, chromosomes unravel, cell cytoplasm splits into two. 3. Compare and contrast mitosis and meiosis using the following table: 1 Initial number of chromosomes Number of chromosomal pairs Number chromosomes after first division Number of dyads after first division Tetrads present? Crossing over? Number of divisions Number of chromosomes after second division Stage when nucleus / nucleolus reforms? Daughter cells haploid or diploid? Mitosis 4 2 4 0 no no 1 n/a telophase diploid Meiosis 4 2 2 2 yes yes 2 2 Telophase II haploid 4. Describe what a karyotype chart is and what it shows. A karyotype is a chart that organizes the chromosomes into pairs from largest to smallest, with the sex chromosomes shown last. It is used to identify genetic anomalies such as non-dysjunctions, chromosomal insertions and deletions. 5. Describe what non-dysjunction is. Give 3 examples of disorders resulting from non-dysjunctions. Non-dysjunction is the unequal separation of chromosomes during anaphase I or anaphase II in meiosis. It could also occur in mitosis. The resulting daughter cells have either one extra or one missing chromosome. This results in some characteristic genetic disorders. Down’s syndrome – trisomy of chromosome 21 Turners syndrome – monosomy of the X chromosome Kleinfeldter’s syndrome – trisomy with XXY Part B: DNA and Protein Synthesis 1. Describe the function /structure of the following: a. Nitrogen bases – single (T,C) or double ring bases (A,G) that carry the genetic code b. Backbone – consists of deoxyribose sugars connected to the nitrogen bases and phosphates c. Hydrogen bonding – holds the DNA bases together with double or triple bonds, also responsible for the spiral d. Codons – 3 bases of mRNA that code for one amino acid e. Anti-codons – 3 bases of tRNA that are attached to one amino acid f. Ribosomes – where proteins synthesis occurs, the amino acids are strung together here g. Transcription – a complementary mRNA strand is formed form the DNA and sent to the ribosomes in the cytoplasm 2 h. Translation – tRNA reads the mRNA and drops off the amino acids in the correct order to create a protein. 2. Compare and contrast DNA and RNA in the table below: DNA RNA deoxyribose Ribose Type of sugar 2 1 Number of Strands nucleus cytoplasm Where found T,A,C,G U,A,C,G Nitrogen Bases 3. For the following strand of DNA, answer the following questions: TACAGGCTACATTAACCCGAGTATTTA a. What is the complementary strand? ATGTCCGATGTAATTGGGCTCATAAAT b. Which enzymes are required for replication? Helicase,DNA polymerase, proofreading enzymes,ligase c. Give the mRNA sequence to the original strand AUGUCCGAUGUAAUUGGGCUCAUAAAU d. How many amino acids will be in this protein? What is the exact sequence? 9 meth – ser – asp – val – iso – gly – leu – iso - asp e. What will the tRNA units look like? UAC AGG CUA CAU UAA CCC GAG UAU UUA meth ser asp val iso gly leu iso asp 4. Draw a flowchart showing the process in protein synthesis. DNA-- transcription - mRNA - Ribosomes- translation - tRNA - amino acids - protein 5. What is meant by “one gene one protein”? Each gene codes for a different protein. A number of proteins together often produce a particular trait 6. Draw a flowchart illustrating the process of gene cloning. Donor gene - cut with restriction enzymes and remove - Host DNA cut with restriction enzyme to open - introduce donor gene into host- supply DNA ligase - gene is inserted, foreign protein can be made 7. Explain what restriction enzymes are and why they are important. Restriction enzymes cut at palindromes and leave sticky ends behind. They are important because they recognize only specific sites and allow us to remove specific genes. The 3 sticky ends are important because we can splice in other pieces of DNA that was cut by the same restriction enzyme. The sticky ends match. 8. What is genetic fingerprinting? Genetic fingerprinting involves cutting the DNA into a series of fragments and identifying those fragments on a gel electrophoresis. Each individual has a specific DNA barcode or signature. This can be used to prove identity of individuals and to prove paternity. 9. What is DNA amplification and why is it used? DNA amplification is the process where DNA is replicated for therapeutic, cloning or investigative purposes. Enzymes and heat are added in alteration to produce a polymerase chain reaction which can make many copies of DNA in a short period of time. 10. Describe 4 types of genetic mutations: 1. Translocation – a gene is removed from one part of the chromosome and re-located at another position 2. Deletion – a single or multiple bases are removed, may cause a frame shift in the way the DNA is read 3. Addition – extra bases may be inserted in the DNA strand, may cause a frame shift 4. Inversion – a gene is removed and re-inserted backwards, this does not change the number of bases, but changes the order Part C: Mendelian Genetics 1. Define / describe each of the following terms: a. Gene – functional unit of DNA that codes for a protein that produces a trait b. Allele – a specific form of one gene c. Dominant – an allele that is expressed over other alleles present d. Recessive – an allele that is only expressed in the homozygous state e. Co-dominant – two alleles that are expressed together f. Homozygous – two alleles are identical g. Heterozygous – two alleles are different h. Genotype – the combination of alleles / genes an individual posesses i. Phenotype – what an individual looks like j. Di-hybrid – an individual who is heterozygous for two alleles k. Sex-linked – a gene found on the X or Y chromosomes l. Autosomal - a gene found on a chromosome other than X or Y 2. For Mexican hairless dogs, the hairless condition is dominant to hairy. A litter of 8 pups is found to consist of 6, which are hairless, and two, which are hairy. What are the genotypes of the parents? Aa x Aa 4 3. Palomino horses are known to be caused by the interaction of two different genes. The Cr in the homozygous condition produces a chestnut (red) horse while the Cm in the homozygous condition produces a cream color called cremello. Heterozygous horses are palomino (reddish bodies with cream manes and tales). What would the expected ratios in the F1 generation be if a cremello horse was mated with a palomino? What if a palomino was mated with a palomino? a) ½ palomino, ½ creamello b) 1 red: 2 palimino: 1 creamello 4. In blood they alleles for types A and B are co-dominant, but both are dominant over the type O allele. The Rh factor is separate from the ABO blood group and RH+ is dominant to Rh-. What are the possible phenotypes of the offspring in the mating between a woman who is blood type AB and heterozygous Rh+ with a man who is heterozygous for type A blood and is also heterozygous for the Rh factor? A+, AB+, AB-, A-, AB- 5. Colorblindness is a sex-linked recessive trait. What would the phenotypes and genotypes of the offspring be if a colorblind man mates with a heterozygous normal sighted woman? Phenotypes: 1 normal female: 1 colorblind female: 1 normal male: 1 colorblind male Genotypes: 1 XAXa: 1XAy: 1XaXa: 1XaY (A= normal, a =colorblind) 5 6. Identify the type of inheritance in the pedigree chart below. Identify the genotypes for each individual listed. Autosomal Recessive 7. Use the following chart of crossover frequencies to plot a gene map. Gene combination Recombination Frequencies VF/B VF/C B/C B/S VF/S C/S 2.5% 3.0% 5.5% 5.5% 8.0% 11.0% C-----3----VF---2.5---B----------5.5-----------------S 8. Identify the following processes that involved biotechnology and genetics. What is each used for? How is each done? Recombinant DNA – DNA that comes form two different individuals. This allows one individual to make new proteins it couldn’t make before Cloning – is the process of replicating specific genes or replicating specific individuals Gene Therapy – is the process where an individuals DNA is altered for therapeutic purposes. A defective gene is replaced with a functional gene. The gene is often introduced by viral or bacterial vectors Ames Test – is a test used to determine whether a substance is likely to be carcinogenic (cancer causing). Bacteria that require histidine as a nutrient are exposed to a potentially carcinogenic substance, then grown in the absence of histidine. If they survive, a mutation has occurred allowing them to produce histidine and the substance is likely mutagenic and possible carcinogenic. 6